Кодон-оптимізовані послідовності і фармацевтична композиція для відновлення кровоносних судин

 

Винахід відноситься до біотехнології, а саме до генної інженерії і може бути використано у створенні генно-терапевтичних засобів.

Розроблена генетична конструкція, яка дозволяє одночасно експресувати декілька рекомбінантних генів, яка може бути використана в створенні лікарських засобів. На базі генетичної конструкції pBud(Kan) створена рекомбінантна плазміда, що включає оптимізовані за кодонному складу нуклеотидні послідовності генів судинного ендотеліального фактора росту ізоформи 165 (англ. Vascular endothelial growth factor 165, VEGF165) і фактора стромальних клітин 1α (англ. Stromal cell-derived factor-1, SDF1-α),

Судинний ендотеліальний фактор росту VEGF-A, вперше описаний як судинний фактор проникності (англ. Vascular permeability factor, VPF), є основним регулятором ангіогенезу і васкулогенеза. VEGF-A - це димерний 34-42 кДа дисульфід-пов'язаний глікопротеїн. VEGF-A є специфічним митогеном для судинних ендотеліальних клітин. VEGF-A індукує проліферацію ендотеліальних клітин (ЕК), їх проростання і формування каппилярних трубочок. Він також є потужним фактором виживання для ЕК і індукує експресію антиапоптозних білків у цих клітинах. Делеції >p>Ген VEGF-A людини розташований у хромосомному локусі 6р21.3. Кодує область охоплює близько 14 т. п. н. VEGF-A існує в декількох изоформах: VEGF121, VEGF145, VEGF148, VEGF165, VEGF183, VEGF189, VEGF206, утворених в результаті альтернативного сплайсингу мРНК, яка складається з 8-ми екзонів. Кожній изоформе VEGF відповідає певна позаклітинна локалізація, заснована на їх біохімічних відмінності в здатності зв'язувати гепарин - і гепаран-сульфат. Так, всі транскрипти гена VEGF-A у людини містять экзони 1-5, 8, відмінності ж обумовлені альтернативним сплайсингом екзонів 6 і 7.

VEGF165 - ізофрома, що переважає в більшості тканин і є найбільш біологічно активною, вона представляє собою основний білок, здатний зв'язувати гепарин, і, хоча значна його частка залишається пов'язаної з кліткою, велика частина вільно секретується. У даної ізоформи відсутні амінокислотні залишки, включення яких в білкову молекулу кодується экзоном 6. Дана ізофрома є фізіологічно найбільш часто зустрічається і біологічно найбільш активною. VEGF165 зазвичай секретується у вигляді 46 кДа гомодимери, обидві субодиниці якого мають масу 23 кДа.

Фактор стромальних клітин альфа 1 (англ. Stromal cell-derived factor-1 а 12 (Chemokine ligand 12, CXCL12 alpha). SDF-1 alpha і beta активують протизапальні процеси. CXCL12 викликає хемотаксис лімфоцитів.

CXCL12 є лігандом рецептора CXCR4. Передача сигналів CXCR4-CXCL12 викликає хемотаксис, збільшення проліферації та зниження апоптозу. Під час ембріогенезу він керує міграцією кровотворних клітин з печінки плоду в кістковий мозок і формуванням крупних кровоносних судин. У зрілому віці CXCL12 відіграє важливу роль у ангиогенезе шляхом залучення ендотеліальних клітин-попередників (англ. Endothelial progenitor cells, EPCs) з кісткового мозку через СХС114-залежний механізм.

Приклад застосування генно-інженерної конструкції pBud(Kan) полягає у створенні рекомбінантної плазміди pBud(Kan)-coVEGF165-coSDF1-α.. При захворюваннях людини, пов'язаних з порушенням кровопостачання і пошкодженнями кровоносних судин, формування нових елементів судинної мережі завдяки експресії факторів VEGF165 і SDF1-α здатне відновити кровопостачання уражених тканин і органів, а також викликати стабільний позитивний ефект. При використанні генно-терапевтичних препаратів in vivo тільки частина клітин трансфицируется плазмідної ДНК. При використанні окремих генетичних конструкцій для експресії індивідуальних теронструкциями значно знижуються.

Причиною об'єднання саме генів vegf і sdf-1 в одній плазмиде стало встановлення в процесі досліджень потенцирующего ефекту експресії зазначених генів, що виявляється не тільки у підвищенні продукції терапевтичних білків, що ними кодуються, але і в остаточному біологічний ефект. Крім того, несподівано встановлено, що трансфекція клітин ДНК плазміди з геном vegf забезпечує не тільки підвищення продукції власне білка VEGF, але також і білка SDF-1 (Рис. 1).

Принцип дії генно-інженерної конструкції pBud(Kan)-coVEGF165-coSDF1-α заснований на тому, що препарат вводиться системно або місцево, за цим слідує спонтанна трансфекція резидентних клітин, в тому числі ендотеліальних, потім експресія генів vegf і sdf-1. Експресія мРНК генів vegf і sdf-1 контролюється двома сильними эукариотическими промоторами (негайний ранній промотор цитомегаловірусу CMV і промотор EF1 альфа) і відбувається незалежно. Після процесингу з мРНК генів vegf і sdf-1 синтезуються білки VEGF 165 і SDF1-α, які виявляють свою нормальну біологічну активність як судинний ендотеліальний фактор росту і фактор стромальних клітин.

Роботи по використанню VEGF 165 в терапевтичному ангиогенезе широко проводяться в усьому миѰзмиди, містить VEGF 165 [1]. Важливо, що до сьогоднішнього дня не зареєстровано небажаних або серйозних небажаних явищ, пов'язаних із застосуванням плазмід, які містять судинний ендотеліальний фактор росту, або ускладнень після їх застосування.

Більш того, на сучасному рівні розвитку прикладних генних технологій, об'єднання декількох генів, що кодують терапевтичні білки, в складі однієї генної конструкції стає все більш і більш поширеним підходом. Зокрема, відомі такі варіанти об'єднання, як гени vegf-165 і bmp-7 у аденовірусної векторі [2], та ін. Іншим варіантом є полицистронная плазмидная ДНК, що кодує відразу чотири гена (oct4, sox2, klf4, and c-myc) показана для репрограммирования соматичних клітин в індуковані плюрипотентні стовбурові клітини [3]. Потрібно зазначити, що деякі автори вже згадували потенційну доцільність і здійснимість об'єднання генів sdf-1 і vegf в одному экспрессионном векторі для терапевтичних показань [4] У вищезгаданих публікаціях дослідники не наводять конкретних описів нуклеотидних послідовностей і навіть не уточнюють, які саме варіанти генів sdf-1 і vegf вони мали на увазі, приводячи лише загальні гипотетиче�рующего строго певні ізоформи терапевтичних білків, коректна оптимізація нуклеотидних послідовностей трансгенів, розробка адекватного экспрессионного вектора визначає досягнення основного технічного результату, яким може бути тільки біологічна ефективність розробленої генно-терапевтичної конструкції, а не власне здійснимість її створення.

Завданням цього винаходу є створення плазмідної генно-інженерної конструкції, яка дозволяє одночасно експресувати декілька рекомбінантних генів, проявляє високу функціональну активність.

Короткий опис малюнків

Рис. 1. Динаміка продукції мРНК генів vegf і sdf-1α культурою ММСК, трансфицированной плазміди з одним геном vegf.

Рис. 2. Імунофлуоресцентного аналіз експресії VEGF 165 і SDF-1α у клітинах лінії SH-SY5Y, трансфицированних плазміди pBud(Kan)-VEGF 165-SDF-1α. 48 годин інкубації після трансфекції. А, Б, В, Г, Д, Е, Ж, 3 - клітини SH-SY5Y, трансфицированние плазміди pBud(Kan)-VEGF 165-SDF-1α. І, До, Л, M - нетрансфицированние клітини SH-SY5Y. А, Д, І, - фазово-контрастна світлова мікроскопія. Б - фарбування за допомогою первинних антитіл кролика до фактору стромальних клітин 1 і вторинних антитіл осла до иммуноглобулину G кролика, кон'югованих з флуоресцентнойа і вторинних антитіл осла до иммуноглобулину G кролика, кон'югованих з флуоресцентною міткою Alexa-488. В, Ж, Л - фарбування флуоресцентним барвником DAPI. Г, З, M - поєднання синього і зеленого спектрів флуоресценції. Шкала: 100 мкм.

Рис. 3. Вестерн блот аналіз експресії білків VEGF 165 і SDF1-1α в генетично модифікованих клітинах HEK293T. Електрофорез у 12% SDS-PAGE гелі по системі Лаэмли. Антитіла до VEGF (Santa cruz biotechnology; sc-507. Лунки 1 і 2) і антитіла до SDF1 (Santa cruz biotechnology; sc-28876. Лунки 3 і 4) використовувалися в розведенні 1:50. Очікуваний розмір білка VEGF 165 - 42 кДа, SDF-1α - 10 кДа. Лунки 1, 3 - клітини НЕК293Т, трансфицированние плазміди pBud(Kan)-VEGF165-SDF-1α. Лунки 2, 4 - нетрансфицированние клітини HEK293T. M - маркер Prestained Protein Molecular Weight Marker (Thermo Fisher Scientific Inc.).

Рис. 4. Формування капилляро-подібних структур ендотеліальними клітинами HUVEC на Матригеле. Додавання до культурального середовища в кінцевій концентрації 30%, зібраної з клітин HEK293T, трансфицированних плазміди pBud(Kan)-VEGF165-SDF-1α (А), Б - культуральна середовище нетрансфицированних клітин (NTC) у кінцевій концентрації 30%. Шкала: 500 мкм.

Рис. 5. Продукція хемокінів/цитокінів ІЛ-8, МСР-1 нативними (NTC) та генетично модифікованими клітинами hADSCs.

Для створення конструкції використаний экспрессионний вектор pBudCE4.1 (Invitrogen, Catalog #V532-20, США), який містить промльность плазмідного вектора pBudCE4.1:

1. Послідовність гена стійкості до зеоцину і його промотор замінені на послідовність гена стійкості до канаміцину. Гени стійкості до зеоцину і канаміцину використовують як для селекції плазмідного вектора у клітинах бактерій, так і для селекції трансфицированних плазмидним вектором эукариотических кліток. Заміна гена стійкості до зеоцину обумовлена тим, що його експресія в эукариотических клітинах (в тому числі клітинах людини) призводить до появи чужорідного білка (продукту експресії гена), який може викликати поява стійкості до антибіотика та представляти собою потенційний алерген.

2. Видалені послідовності тегів V5-His і myc-His.

В якості прикладу реалізації генно-інженерної конструкції pBud(Kan) створена рекомбінантна плазміда pBud(Kan)-coVEGF165-coSDF1-α (SEQ ID NO:1), що представляє собою модифіковану експресійної векторну плазміду pBudCE4.1 в якій клоновані кодон-оптимізовані кДНК, що кодують фактор стромальних клітин 1 альфа і судинний ендотеліальний фактор росту ізоформи 165 (по сайтах рестрикції HindIII та XbaI), містить:

owspan="0">- Сайти Gateway attBI і attBII
Промотор CMV11-627
670-694 і 969-993
- Ген coSDF1-α699-968
- Ген стійкості до канаміцину1272-2313
Промотор EF1-α2329-3496
- Сайти рестрикції HindIII та XbaI3515-3520 і 4101-4106
- Ген coVEGF1653525-4100

Кодонная оптимізація заснована на виродженість генетичного коду, при цьому в якості оптимальних кодонов використовують найбільш часто зустрічаються синонімічні кодони виродженого генетичного коду. Чим вище частота зустрічальності того чи іншого кодона, який використовується для кодування амінокислоти в організмі, тим з більшою швидкістю він буде транслюватися рибосомами внаслідок високої внутрішньоклітинної концентрації тРНК, узнающей такий ко дон. Для оптимізації кодонного складу генів vegf і sdf-1 використовували алгоритм OptimumGene, який враховує різні фактори, що впливають на рівні експресії генів, такі як зсув кодонов, GC-складу, утримання CpG-динуклеотидов, вторинну структуру мРНК, тандемн�, �ополнительние мінорні сайти зв'язування з рибосомой. В якості матриці для ко донної оптимізації були взяті нуклеотидні послідовності мРНК генів vegf (GeneBank #AF486837.1, 576 п. н.) і sdf-1 (GeneBank #AY429472.1, 270 п. н.).

Дикий тип нуклеотидних послідовностей кодуючої частини генів vegf і sdf-1 містять тандем рідкісних кодонов, які можуть зупинити трансляцію або знизити її ефективність. При оптимізації кодонного складу дикого типу гена sdf-1 був поліпшений індекс адаптації кодонов CAI (англ. Codon Adaptation Index) з 0,77 до 0,88. При оптимізації кодонного складу дикого типу гена VEGF 165 був поліпшений індекс адаптації кодонов CAI з 0,81 0,87. Для збільшення стабільності мРНК був оптимізований GC-складу і видалені протяжні ділянки з високим сожержанием GC-пар. Крім того, процес оптимізації видалив потенційні цис-діючі сайти. В результаті до донної оптимізації амінокислотні послідовності генів SDF1-A (SEQ ID N0:2) і VEGF165 (SEQ ID NO:3) не змінилися і склали 89 і 191 амінокислотних залишків, відповідно.

Синтез de novo нуклеотидної послідовності плазміди pBud(Kan)-coVEGF165-coSDFl-α, що включає оптимізовані за ко донному складу кДНК генів vegf і sdf-1, був здійснений компанією GenScript (США). Таким чином, отримана плазми�ьная активність генетичної конструкції підтверджувалася аналізом експресії трансгенів in vitro.

Генну модифікацію (трансфекцію) клітинних ліній НЕК293Т і SH-SY5Y з допомогою отриманої генетичної конструкції pBud(Kan)-VEGF165-SDF-la проводили трансфекционним агентом TurboFect (Thermo Fisher Scientific Inc., США) відповідно до методики, рекомендованої виробником.

Для оцінки експресії генів vegf і sdf-1 в трансфицированних клітинах НЕК293Т і SH-SY5Y проводили імунофлуоресцентного і вестерн блот аналізи.

Імунофлуоресцентного аналіз клітин SH-SY5Y, трансфицированних плазміди pBud(Kan)-VEGF165-SDF-la, виявив позитивну реакцію з поликлональними антитілами кролика до сосудисому эндотелиальному фактору росту і фактору стромальних клітин 1 (Рис. 1).

Білкові лізати клітин НЕК293Т, трансфицированних плазміди pBud(Kan)-VEGF165-SDF-1α аналізували за допомогою вестерн блот аналізу, який показав наявність виражених смужок, які відповідають очікуваним молекулярним масам білків VEGF 165 і SDF-1α - 42 кДа і 10 кДа, відповідно (Рис. 2).

Після трансфекції клітин лінії НЕК293Т генетичної конструкцією pBud(Kan)-coVEGF165-coSDF1-α з використанням трансфекционного агента TurboFect (Thermo Fisher Scientific Inc.), аналіз експресії рекомбінантного білка проводили за допомогою імуноферментного аналізу (ІФА).

Збір культурального середовища з лунок з клітинами НЕК-293пробирки і центрифугували протягом 1 хвилини при максимальних обертах для видалення клітинних уламків (дебриса). Супернатант переносили в чисті 1,5 мл пробірки, розводили в 10 разів і використовували для імуноферментного визначення концентрації VEGF. Концентрацію VEGF у культуральному середовищі визначали за допомогою набору VEGF-ІФА-БЕСТ А-8784 (Вектор, Росія) за методикою, рекомендованої виробником. Метод визначення заснований на твердофазній «сендвіч» варіанті імуноферментного аналізу із застосуванням моно - та поліклональних антитіл до VEGF людини. Діапазон вимірюваних концентрацій 0-2000 пг/мл, чутливість аналізу - 10 пг/мл Оптичну густину в лунках визначали з використанням багатофункціонального мікропланшетного рідера Infinite М200Рго (Тесап) у двохвильовому режимі: основний фільтр - 450 нм, референс-фільтр - 655 нм. Виходячи з прямої пропорційності між величиною оптичної щільності і концентрації VEGF в стандартних зразках, вираховували концентрацію VEGF в досліджуваних зразках.

Клітини HEK293T, трансфицированние pBud(Kan)-coVEGF165-coSDF1-α з допомогою реагенту TurboFect, показували високий рівень експресії VEGF на 1 день після трансфекції (1542 пг/мл) порівняно з нативними (нетрансфицированними) клітинами (28 пг/мл).

Таким чином, показана експресія білка VEGF 165 отриманої генетичної конструкцією pBud(Kan)-coVEGF 165-coSDF1-α.

ud(Kan)-VEGF165-SDF-1α оцінювали вплив кондиціонованому середовища на формування капилляро-подібних структур ендотеліальними клітинами HUVEC на Матригеле (Matrigel™ Matrix, BD Biosciences, San Diego, CA, США) [2].

Було показано, що кондиціонована середовище клітин НЕК293Т, генетично модифікованих плазміди pBud(Kan)-VEGF 165-SDF-1α, стимулює формування капилляро-подібних структур клітинами HUVEC in vitro (Рис. 3).

Отриманий генно-інженерна конструкція pBud(Kan) може бути використана для створення генно-терапевтичних препаратів.

Рекомбінантні плазміди, створені на основі генно-інженерної конструкції pBud(Kan), можуть бути використані у складі фармацевтичної композиції для отримання готової лікарської форми.

Фармацевтична композиція для відновлення кровопостачання тканин та (або) органів містить генно-інженерну конструкцію pBud(Kan)-coVEGF165-coSDF1-α в ефективному кількості та фармацевтично допустимі допоміжні речовини.

В одному з варіантів фармацевтична композиція може містити, у тому числі, добавку для трансфекції клітин людини (мононуклеарні клітини крові або кісткового мозку людини, мезенхімні стовбурові клітини та ін) у разі реалізації генно-клітинного підходу і трансплантації ген-оптимізованих клітин.

Розчин pBud(Kan)-coVEGF165-coSDF1-α, придатний для подальшого отримання фармацевтичної композиції і готової лекарственнданной області техніки.

Готова лікарська форма pBud(Kan)-coVEGF165-coSDF1-α повинна бути придатна для проведення генної терапії і не повинна приводити до істотної зміни властивостей основної речовини при тривалому зберіганні. Можлива готова лікарська форма плазміди може бути обрана з групи замороженого розчину, рідкого розчину, лиофилизата, тобто ліофільно висушеного розчину, аморфної плівки, але не обмежується ними.

Кращими варіантами готової лікарської форми є рідкий розчин або порошок, оскільки вони можуть зберігатися при позитивній температурі, тобто в стандартних фармацевтичних холодильниках, і не вимагають значного часу для підготовки до ін'єкції.

Найбільш кращим варіантом готової лікарської форми є ліофілізат, оскільки відсутність води потенційно сповільнює хімічні реакції розпаду ланцюгів ДНК.

Отримання лиофилизата, тобто аморфної або мікрокристалічної пористої маси, вимагає присутності в лиофилизуемом розчині допоміжних речовин, що виконують функції криопротектанта, стабілізатора pH, хелатируючого агента, антиоксиданту, наповнювача і т. д. Мінімально можливий набір допоміжних вещесѰтор pH. Допоміжна речовина, що є криопротектантом і наповнювачем, може бути обраний із групи, що включає моно - і дисахариди, поліоли і полімери, такі як: сахароза, лактоза, трегалоза, манітол, сорбітол, глюкоза, раффиноза, полівінілпіролідон або їх поєднання. Стабілізатор pH може бути обраний із групи, що включає цитрат натрію, фосфат натрію, Трис-HCl, Трис-ацетат, гліцин та інші амінокислоти.

Спосіб отримання лиофилизата може передбачати додавання до розчину очищеної плазмідної ДНК розчинів, щонайменше, одного криопротектанта, що володіє властивостями наповнювача, і стабілізатора pH з отриманням ізотонічного розчину з концентрацією очищеної плазмідної ДНК від 0,1 до 10 мг/мл та рн від 7,0 до 9,0 і подальшу лиофилизацию і зберігання при температурі від +2°C до +8°C.

Спосіб застосування фармацевтичної композиції полягає у введенні її людини (або тварин) таким способом і в такій кількості, які забезпечують лікувальний ефект залежно від нозологічної форми та медичних показань.

Фармацевтична композиція може вводитися місцево - внутрішньом'язово, підшкірно, внутрішньошкірно, системно - внутрішньовенно, внутрішньоартеріально, аерозольно, у вигляді генно-клетоеских і їх більш диференційованих похідних, мезенхімних, судинно-стромальной фракції, мезангиобластов, міобластів, миосателлитоцитов та ін

Хоча зазначені винаходу описані в деталях, для фахівця в даній області техніки, очевидно, що можуть бути здійснені різні зміни зроблені еквівалентні заміни, і такі зміни і заміни не виходять за рамки цього винаходу.

В даний час в світі використовується ряд подібних конструкцій, де в якості вставки використана кДНК гена VEGF165, а в якості вектора - різні плазміди [3, 4].

Порівняно з існуючим прототипом [4], генетичної конструкцією pBud-VEGF165-FGF2, генно-інженерна конструкція pBud(Kan)-coVEGF165-coSDF1-α володіє наступними перевагами:

1. Генно-інженерна конструкція pBud(Kan)-coVEGF165-coSDF1-α містить оптимізовані за кодонному складу кДНК генів vegf і sdf-1, що покращує трансляцію продуктів цих генів і знижує можливість гомологічної рекомбінації з відповідними послідовностями на хромосомах людини.

2. Генно-інженерна конструкція pBud(Kan)-coVEGF165-coSDF1-α містить безпечну для клінічного застосування послідовність гена стійкості до антибіотика канаміцину для селекції плазміди тільки в клітинах бактерій.

3. Одновреме�орами CMV і EF1-α. Одночасна експресія двох генів в одній клітці дозволяє досягти більш рівномірного градієнта секретуються рекомбінантних білків. Крім того, трансфекція клітин плазміди pBud(Kan)-coVEGF165-coSDF1-α призводить до більш високої експресії хемокінів/цитокінів ІЛ-8, МСР-1 в порівнянні з плазміди з геном veg/165 (див. Рис. 5).

Стимуляція продукції трансфицированной кліткою одночасно двох генів - vegf і sdf-1 - призводить до ще більш високої експресії зазначених генів, як привнесених плазміди, так і ендогенних. На 12 добу після трансфекції культури ММСК плазміди pBud(Kan)-coVEGF165-coSDF1-α концентрація (накопичення) білка VEGF у культуральному середовищі була статистично значимо вище, ніж у випадку трансфекції аналогічної культури плазміди лише з одним геном VEGF: 3064,61±22,62 пг/мл і 2259,59±171,56 пг/мл Деталізація внутрішньоклітинних механізмів, що забезпечують такий взаємний потенціюють ефект експресії генів vegf і sdf-1 вимагає проведення подальших досліджень, але існування такого явища підтверджено нашими дослідженнями. Його біологічний сенс полягає в синергичности ефектів, забезпечуваних білками VEGF і SDF-1. Так, при реалізації процесів репаративної регенерації тканин VEGF стимулює проліферацію і диффе� той же час SDF-1 забезпечує міграцію додаткових камбіальних клітин, у тому числі ендотеліальних прогениторних клітин і ГСК, по градієнту концентрації до цільовій зоні, в якій вони потрапляють під дію білка VEGF. Таким чином, обидва терапевтичних білка працюють в парі, стимулюю ангіогенез і репаративну регенерацію. Саме таке синергічну дію могло послужити причиною, по якій експресія зазначених генів має пряму пропорційність, обумовлену, по всій видимості поки не встановленими загальними внутрішньоклітинними шляхами регуляція транскрипції.

4. Генно-інженерна конструкція pBud(Kan) не містить послідовностей тегів V5-His і myc-His.

Таким чином, конструкція pBud(Kan)-coVEGF165-coSDF1-α має важливі переваги з точки зору безпеки та ефективності її використання. Структура конструкції pBud(Kan)-coVEGF165-coSD F1-α принципово відрізняється від усіх існуючих аналогів.

Література

1. Favaloro, L., M. Diez, et al. (2012). "High-dose plasmid-mediated VEGF gene transfer is safe in patients with severe ischemic heart disease (Genesis-I). A phase I, open-label, two-year follow-up trial." Catheter Cardiovasc Interv.

2. Construction of recombinant adeno-associated virus vector co-expressing hVEGF165 and hBMP-7 genes. Huang X., Shi Z., Wang K. et al. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2008; 22(7): 807-13.

3. Induced pluripotent stem cells generated from human adipose-derived stem cells using a non-viral polycistronic plasmid in feeder-free conditions. Qu X, Liu T, Song K, et al. PLoS One. 2012; 7(105.

6. Cherviakov Iu, V., N. I. Staroverov, et al. (2012). "[Therapeutic angiogenesis in treatment of patients with chronic obliterating diseases of lower limb arteries]." Angiol Sosud Khir 18(3): 19-27.

7. Салафутдинов В. І., Ш. А. К., Ялвач М. Е., Кудряшова H. B., Лагарькова M. A., Шутова М. В., Кисельов СЛ., Масгутов Р. Ф., Жданов Р. В., Киясов А. П., Ісламов P. P., Різванов А. А. (2010). "Ефект одночасної експресії різних ізоформ фактора росту ендотелію судин VEGF і основного фактора росту фібробластів FGF2 на проліферацію ендотеліальних клітин пупкової вени людини HUVEC." Клітинна трансплантологія і тканинна інженерія V(2): 62-67.

1. Рекомбінантна плазміда для отримання фармацевтичної композиції, представлена SEQ ID NO:1, в яку клоновані по сайтам для рекомбінації attB1 і attB2 кодон-оптимізована кДНК, представлена SEQ ID NO:2, по сайтів рестрикції HindIII та XbaI кодон-оптимізована кДНК, представлена SEQ ID NO:3.

2. Кодон-оптимізована кДНК, представлена SEQ ID NO:2, що кодує фактор стромальних клітин 1 альфа.

3. Кодон-оптимізована кДНК, представлена SEQ ID NO:3, кодує судинний ендотеліальний фактор росту ізоформи 165.

4. Фармацевтична композиція для відновлення судин і поліпшення кровопостачання в пошкоджених тканинах або органах, містить рекомбина

 

Схожі патенти:

Набір синтетичних олігонуклеотидів для визначення нуклеотидної послідовності кодуючої частини гена des і виявлення мутацій, асоційованих з десминовими кардіоміопатіями

Винахід відноситься до галузі молекулярної біології і може бути використано в діагностиці кардіоміопатій різної природи. Запропонований набір синтетичних олігонуклеотидів для виявлення мутацій кодуючої частини гена десмина (DES), асоційованих з кардіоміопатіями. Мутації виявляють шляхом визначення повної нуклеотидної послідовності кодуючої частини гена DES. Здійснюють ампліфікацію кодуючої частини гена DES з допомогою 7 пар синтетичних олігонуклеотидів при одній температурі та часу відпалу, з подальшим секвенированием отриманих продуктів ампліфікації за допомогою однієї пари універсальних праймерів. Запропоноване винахід дозволяє чутливо і специфічно визначати мутації гена DES, при цьому скорочуються час реакції ампліфікації, кількість маніпуляцій, час внесення реактивів для реакції секвенування і знижується ймовірність помилки при постановці реакції. 2 з.п. ф-ли, 1 іл.

Конкатемери для імуномодуляції

Винахід відноситься до галузі біохімії. Запропоновано конкатемерная молекула некодирующей нуклеїнової кислоти, що містить щонайменше чотири одноланцюгових ділянки з неметилированними CG-мотивами, для модуляції активності імунної системи людини і тварини. Розглянуто містять конкатемерную молекулу фармацевтичні композиції та набір, а також застосування для виготовлення засобу для модуляції імунної системи або для модуляції активності імунної системи людини або тварини молекули та композиції з винаходу. Цей винахід може знайти подальше застосування в якості імуномодулятора в терапії різних захворювань. 5 н. і 15 з.п. ф-ли, 4 іл.

Спосіб виявлення стійких до пиразинамину ізолятів mycobacterium tuberculosis

Винахід відноситься до галузі біохімії, зокрема до способу виявлення стійких до пиразииамиду ізолятів Mycobacterium tuberculosis, шляхом визначення наявності мутацій в гені pncA, асоційованих з формуванням стійкості до пиразинамиду, за допомогою проведення ПЛР в режимі «реального часу» з використанням HRM-аналізу. При цьому проводять ампліфікацію на суміші рівної кількості досліджуваної ДНК і ДНК дикого типу з використанням праймерів: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' і Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', формують гетеродуплекси за рахунок одночасної коамплификации ДНК дикого типу і досліджуваної ДНК, при цьому на першому етапі ПЛР проводять вирівнювання концентрації за допомогою кількісної ПЛР з використанням пари праймерів (Pnc18U/Pnc15R) з побудовою калібрувальної кривої і використанням регресійного рівняння. Винахід завдяки високій специфічності і чутливості дозволяє надійно і швидко визначити тип мутацій в гені pncA, асоційованих з виникненням стійкості до пиразинамиду.1 іл.

Олігопептиди imp-3 і утримують їх вакцини

Винахід відноситься до олигопептидам, що містить послідовність NLSSAEVVV (SEQ ID NO:6), в якій одна або дві амінокислоти можуть бути заміщені, мають индуцибельность цитотоксичних Т-клітин, їх фармацевтичним композиціям і застосування для виготовлення протиракових вакцин. 10 н. і 10 з.п. ф-ли, 6 іл., 1 табл., 1 пр.

Самоиндуцируемая экспрессионная система та її застосування для отримання корисних метаболітів з допомогою бактерії родини enterobacteriaceae

Винахід відноситься до біотехнології і надає собою спосіб отримання корисних метаболітів з використанням бактерії родини Enterobacteriaceae, зокрема бактерії, що належить до роду Escherichia, яка модифікована таким чином, що вона містить генетичну експресійної систему, що включає транскрипційний апарат, регульований білком типу LysR, і модифікована таким чином, що самоиндуцируемая позитивна регуляція за типом зворотного зв'язку зазначеної системи опосередкована коиндуктором. Цей спосіб придатний для продукції L-амінокислот з розгалуженою ланцюгом, зокрема L-валіну, L-ізолейцин і L-лейцину, вищих спиртів і D-пантотенової кислоти. Винахід дозволяє отримувати L-амінокислоти з високим ступенем ефективності. 3 н. і 20 з.п. ф-ли, 2 іл., 5 табл., 6 пр.

Рнк-аптамери, що володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла

Винахід відноситься до галузі біотехнології та медицини і стосується РНК-аптамери. Запропонований РНК-аптамери являє собою 57-звенний олигонуклеотид змішаного типу, що має нуклеотидну послідовність GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, де A,G - рибонуклеотиди, U, С - 2'-дезокси-2'-фторрибонуклеотиди, володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла. Охарактеризованное винахід специфічно і високоафинно зв'язується з аутоантителами, характерними для розсіяного склерозу і може бути використане для діагностики розсіяного склерозу. 3 іл., 2 пр.

Спосіб визначення генотипу людини за поліморфізму в гені матриксною металопротеїнази ммр9-1562 з>т (rs3918242)

Винахід відноситься до галузі біотехнології і може бути використане для визначення генотипу людини за поліморфізму в гені матриксною металопротеїнази ММР9-1562 C>Т (rs3918242). Спосіб заснований на зняття кривих плавлення з флуоресцентно-міченими алель-специфічними олигонуклеотидними пробами. У способі використовують загальну для всіх алелів пару праймерів, що відрізняються для кожного алелю флуоресцентно-мічені алель-специфічні олігонуклеотидні проби і універсальний олигонуклеотид, мічений гасителем флуоресценції наступного нуклеотидного складу: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), де FAM - означає флуоресцентний барвник FAM, HEX - означає флуоресцентний барвник HEX, BHQ1 - означає приєднаний до 5'-кінцевого нуклеотиду темнової гаситель флуоресценції. Віднесення зразка до гомозиготе або гетерозиготе за даним аллелю оцінюється за формою кривих плавлення ДНК - по максимуму першої похідної графіків флуоресценції. Винахід дозволяє підвищити надійність і доступність генотипування. 1 іл.

Спосіб одночасної ампліфікації і флуоресцентного маркування кількох сегментів геному мікобактерій туберкульозного комплексу

Винахід відноситься до біохімії. Винахід забезпечує спосіб одночасної (мультиплексного) ампліфікації і флуоресцентного маркування ДНК декількох сегментів геному мікобактерій туберкульозного комплексу (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum M. microti). Далі проводиться гибридизационний або электрофоретический аналіз послідовностей даних сегментів. Мультиплексна ПЛР здійснюється в єдиному реакційному обсязі з використанням специфічних і адаптерних праймерів, флуоресцентного субстрату, вбудованого в зростаючу ланцюг ДНК в ході ПЛР і геномної ДНК в якості матриці. Мультиплексна ПЛР включає два послідовних профілю ампліфікації, що розрізняються температурами відпалу специфічних і адаптерних праймерів не менш ніж на 10°С. Винахід дозволяє проводити аналіз послідовностей даних генів на виявлення мутацій, асоційованих з стійкістю до протитуберкульозних препаратів. Спосіб за винаходом скорочує число стадій амплификаций для отримання одноланцюгових флуресцентно-мічених ПЛР-продуктів, виключає перенесення ДНК-матриці з одного реакційного об'єму в іншій, що підвищує стійкість до процедури контамінації ПЛР-продуктами і істот

Спосіб отримання иммуногенной композиції на основі гібридного білка cfp10-dbd і декстрану, рекомбінантна плазміда pcfp10-dbd, штам escherichia coli [prep4, pcfp10-dbd], химерний білок cfp10-dbd та їх застосування

Група винаходів відноситься до генної інженерії, біохімії, біотехнології та імунології. Представлена рекомбінантна плазміда pCFP10-DBD, що складається з штучного бактеріального оперона химерного білка, що включає промоторную область раннього промотору бактеріофага Т5, ген химерного білка, що складається з послідовності білкового антигену CFP10 з Mycobacterium tuberculosis, злитої з послідовністю декстрансвязивающего домену (DBD) декстрансукрази Leuconostoc citreum KM20, і термінатор транскрипції, бактеріального оперона бета-лактамази і бактеріального ділянки ініціації реплікації типу ColE1. Також представлений штам Escherichia coli - продуцента химерного білка CFP10-DBD. Описаний спосіб іммобілізації, концентрування та очищення отриманого білка на целюлозі. Описана иммуногенная композиція, що містить рекомбінантний білок CFP10-DBD, спрямована на індукцію імунітету проти туберкульозної інфекції. Винахід розширює арсенал засобів, які використовуються для лікування туберкульозу. 4 н. п. ф-ли, 6 іл., 1 табл., 4 пр.

Пристрій для автоматичного очищення біологічних зразків, оснащене елементом для прикладання магнітного поля, спосіб вилучення цільового речовини з біологічного зразка і спосіб експресії і очищення білка

Заявлена група винаходів відноситься до галузі біології, зокрема до устаткування для автоматичного очищення біологічних зразків при виділенні цільових речовин з безлічі біологічних зразків, для автоматичного очищення біологічного зразка, оснащене елементом для прикладання магнітного поля, в якому елемент для прикладання магнітного поля для очищення біологічних зразків і нагрівальний елемент сформовані у вигляді єдиного компонента один з одним так, щоб бути рухливими вгору і вниз. Пристрій для автоматичного очищення містить блок 100 піпеток, який розміщений з можливістю вертикального і горизонтального переміщення, у який з можливістю видалення встановлено безліч піпеток 141, 142 для всмоктування та виведення матеріалу текучого середовища, нагрівальний елемент 810 для нагрівання конкретного блоку лунок многолуночного планшета 420, 420', елемент 700 для прикладання магнітного поля, встановлений на опорній плиті 400, містить елемент 710 для установки магніту. На елементі 700 змонтований магніт 711, розміщений у нижній сторони конкретного блоку лунок многолуночного планшета 420, 420', і підйомний елемент 760 для підйому вгору і опускання вниз елемента 710 длѽшета 420, 420', розміщеним в нижній боку блоку 100 піпеток, і видаляти від нього. В способі витягу цільового речовини з біологічного зразка використано пристрій для автоматичного очищення біологічного зразка, оснащене елементом програми магнітного поля. Винаходи забезпечують підвищення ефективності і якості виділення та очищення. 6 н. і 20 з.п. ф-ли, 48 іл.
Up!