Рекомбінантні антитіла проти фактора росту ендотелію судин (vegf), отримані за допомогою мутагенезу змінної області

 

Область винаходу

Даний винахід відноситься до галузі біотехнології і фармацевтичної промисловості, зокрема, до розробки і застосування рекомбінантних антитіл людини, які специфічно розпізнають фактор росту ендотелію судин А людини (скорочено VEGF-A) (Ferrara, N. et al. 2003. Nature Medicine 9: 669-676). Різні типи рекомбінантних антитіл, що охоплюються цим винаходом, були отримані шляхом комбінування змінної галузі легкої ланцюга (VL) з іншими трьома вариабельними галузями важкої ланцюга (VH) одного і того ж імуноглобуліну методами генної інженерії. Рекомбінантні антитіла, які розпізнають епітоп VEGF-A, не описані раніше, блокують взаємодію VEGF-A зі своїм рецептором VEGFR2, і в результаті чого, перешкоджають стимулюючого і проангиогенному ефекту VEGF-A в умовах in vitro та in vivo. Завдяки цим властивостям, нові рекомбінантні антитіла людини можуть використовуватися для імунотерапії патологічних утворень, пов'язаних із збільшенням судинної мережі, таких як, вікова макулодистрофія, злоякісне новоутворення, ревматоїдний артрит та інших.

Існуючий рівень техніки

Процес утворення нових кровоносних судин з вже існуючих (ий і його клітини-попередники в кістковому мозку. Фактори росту ендотелію судин є сімейством молекул, які безпосереднім і певним чином викликають утворення нових судин (Leung, D. et al. 1989. Science 246:1306-1309). Це сімейство включає судинний фактор проникності (скорочено VPF), також відомий як фактор росту ендотелію судин (VEGF-A), плацентарний фактор росту (скорочено PLGF), тромбоцитарний фактор росту А і В (скорочено PDGF), та інші молекули, що відносяться структурно і біохімічно до VEGF-A, які були позначені як, VEGF-В, VEGF, VEGF-D і VEGF-Е (Olofsson, B. et al. 1996. Proc Natl Acad Sci USA 93: 2576-2581; Joukov, V. et al. 1996. EMBO J 15:290-298; Yamada, Y. et al. 1997. Genomics 42:483-488; Ogawa, S. et al. 1998. J Товарbiol Chem 273:31273-31282).

VEGF-А - гомодимерний глікопротеїн, утворений двома субодиницями масою 23 кДа (Ferrara, N. et al. 1989. Biochem Biophys Res Comun 161:851-858). Існує п'ять ізоформ, що виникли в результаті диференціального сплайсингу однієї і тієї ж рибонуклеїнової кислоти (РНК). Вони містять дві мембрансвязанние ізоформи (VEGF 189 та VEGF 206) і три, секретирующихся у вигляді розчинних факторів (VEGF 121, VEGF 145 і VEGF 165). VEGF 165 найбільш широко поширений в тканинах ссавців, за винятком серця та легенів, де переважає VEGF 189 (Neufeld G et al. 1995. Canc Met Rev 15:153-158). У плаценті дуже висока експресія VEGF 121 (Shibuya, M. 1995. Adv Cancer Res 67:281-316). З�рамі III класу, які містять VEGFR1 (Flt1), VEGFR2 (KDR/Flk1) і VEGFR3 (Flt4) (Kaipainen, A. 1993. J Exp Med 178:2077-2088).

VEGF-A є найбільш вивченим і охарактеризованним білком даного сімейства і вже описані деякі захворювання, при яких цей білок пов'язують з патогенетичним процесом (Carmeliet, P. y Jain, RK. 2000. Nature 407:249-257; Kuwano M, et al. 2001. Intern Med 40:565-572). Гіперекспресія VEGF-A пов'язана з ростом пухлин різного генезу та локалізації, а також і з їх метастазуванням (Grunstein, J. et al. 1999. Cancer Res 59:1592-1598). При певних пухлинах, клітини, які експресують три основні ізоформи VEGF-A (121, 165 і 189), є єдиними швидкозростаючими в умовах in vivo (Grunstein, J. 2000. Mol Cell Товарbiol 20:7282-7291).

VEGF-A також пов'язують з хронічними запальними процесами, такими як неспецифічний виразковий коліт і хвороба Крона (Kanazawa, S. et al. 2001. Am J Gastroenterol 96:822-828), псоріаз (Detmar M. et al. 1994. J Exp Med 180:1141-1146), респіраторний дистрес-синдром (Thickett, DR. et al. 2001. Am J Respir Crit Med Care 164:1601-1605), атеросклероз (Celletti, FL. et al. 2001. Nat Med 7:425-429), ендометріоз (McLaren, J. 2000. Hum Reprod Update 6:45-55), астма (Hoshino M. et al. 2001. J Allergy Clin Immunol 107:295-301), ревматоїдний артрит і остеоартрит (Pufe, T. et al. 2001. J Rheumatol 28:1482-1485), тиреоїдит (Nagura, S. et al. 2001. Hum Pathol 32:10-17), діабет і ретинопатія новонароджених (Murata, T. et al. 1996. Lab Invest 74:819-825; Reynolds, JD. 2001. Paediatr Drugs 3:263-272)641), ожиріння (Tonello, C. et al. 1999. FEBS Lett 442:167-172), гемангіома (Wizigmann, S. y Plate, KH. 1996. Histol Histopathol 11:1049-1061), запальні артропатії (Bottomley, MJ. et al. 2000. Clin Exp Immunol 119:182-188) і відторгнення трансплантата (Vasir, B. et al. 2001. Transplantation 71:924-935).

Перспективний терапевтичний метод для багатьох з перерахованих вище захворювань заснований на інгібуванні активності проангиогенних чинників, які викликають утворення аномальних кровоносних судин, за допомогою молекул, здатних нейтралізувати їх дію. Багато з нових терапевтичних стратегій, заснованих на інгібуванні ангіогенезу, особливо для злоякісних новоутворень, засновані на блокуванні VEGF-A та/або його рецепторів. Серед препаратів, дозволених для клінічного дослідження, автори виділяють: (1) моноклональні антитіла, які блокують VEGF-A або KDR-рецептор, (2) інгібітори металопротеїназ, такі як, неовастат і приномастат, (3) інгібітори VEGF, такі як талідомід, сурамин, тропонин I і IFN-α, (4) блокатори рецепторів VEGF, такі як, SU5416, FTK787 і SU6668, (5) індуктори апоптозу пухлини ендотелію, такі як Эндостатин і CA4-P, а також, (6) рібозіми, які знижують експресію VEGF або його рецепторів (ангиозим).

З усього перерахованого вище, антитіла і фрагменти антите�втических коштів. У медичній практиці гуманізоване рекомбинантное антитіло бевацізумаб (комерційна назва-Авастин (Ferrara, N. et al. 2005. Biochem Biophys Res Comun 333:328-335; Kim, KJ. et al. 1992. Growth Factors 7:53-64), яке розпізнає VEGF-А людини і нейтралізує його проангиогенний ефект, було дозволено до застосування в декількох країнах для лікування пухлин різного генезу (Allison, M. 2010. Nature Biotechnology, 28(9):879-880).

За останній час в деяких країнах було отримано дозвіл на застосування ранибизумаба (комерційна назва - люцентіс) (Gaudreault, J. et al. 2005. Invest Ophthalmol Visual Sci 46:726-733) для лікування вікової макулодистрофії, її ексудативної форми. Ранибизумаб являє собою Fab-фрагмент рекомбинатного антитіла, розроблений шляхом обробки бевацизумаба методами генної інженерії. Ін'єкція ранибизумаба в склоподібне тіло нейтралізує локально продукується VEGF-А і порушує неоангиогенез в глибоких шарах сітківки, який лежить в основі даного захворювання.

Крім прикладів з бевацизумабом та ранибизумабом, які вже зареєстровані органами санітарного нагляду, є повідомлення за іншим антитілам і фрагментів антитіл, які розпізнають і нейтралізують VEGF людини (Muller, Y. et al. 1997. Proc Natl Acad Sci USA 94:7192-7197; Asano M. et al. 1998. Hybridoma 17r Res 60:5117-5124; Fuh, G. et al. 2006. J Товарbiol Chem 281:6625-6631; US 5730977; WO2008/052489 A1).

2H1 - одноцепочечний фрагмент Fv антитіла людини (скорочено scFv), який специфічно розпізнає VEGF людини (WO2008/052489 A1). 2H1 був отриманий з вихідного scFv людини бібліотеки филаментного фагового дисплею. 2H1 scFv специфічний для VEGF-А людини, однак, виявляє низьку афінність до цієї молекулі. Це може бути пояснено, якщо взяти до уваги, що бібліотека, з якої він узятий, була створена з вихідних варіабельних областей, отриманих з лімфоїдних клітин людини з різних джерел (периферичної крові, селезінки, мигдаликів, кісткового мозку) і від різних здорових індивідів (Rojas G., et al. 2005. Biochem Biophys Res Comun 336:1207-1213). Як відомо з існуючого рівня техніки, відображений фагом scFv з бібліотек наївних варіабельних областей, може продукувати антитіла середньої і низької афінності до їх специфічних антигенів. Це може бути добре відомо в разі власних антигенів, а також, і в даному випадку (Marks J. D., et al. 1991. J. Mol. Товарbiol. 222:581-597). Середня або низька спорідненість антитіла, як правило, відповідає наявності малого числа мутацій у варіабельних областях щодо послідовностей імуноглобуліну зародкової лінії, з якого вони возниии і терапевтичних методів в умовах in vivo, порівняно з подібними молекулами, що володіють високою аффинностью до того ж самого антигену.

В даний час інтерес спрямований на створення нових антитіл, які нейтралізують ефекти VEGF людини, і також можуть бути використані в терапії утворень, які виявляються внаслідок надмірного ангіогенезу.

Опис винаходу

Даний винахід вирішує зазначену проблему, оскільки пропонує нові рекомбінантні антитіла людини, які специфічно розпізнають VEGF-А людини.

Різні рекомбінантні антитіла, описані в цьому винаході, показують чудові імунохімічні, біологічні та терапевтичні характеристики порівняно з подібними молекулами, отриманими з 2Н1 фрагмента антитіла scFv. Для розробки таких антитіл, були викликані мутації в гипервариабельних ділянках 3 (CDR3) варіабельних галузей легкої VL і важкої VH ланцюга 2Н1 фрагмента антитіла scFv. Нові мутовані вариабельние ділянки, виділені для кращого розпізнавання VEGF-А людини з використанням технології филаментного фагового дисплею, скомбіновані з допомогою методів генної інженерії для отримання нових зв'язуючих ділянок антитіла з потрібними усо�перші проведено аналіз послідовностей генів, кодують 2Н1 scFv фрагмент антитіла, який показав, що CDR3 VL і VH мали дуже невеликі зміни щодо V, D і/або J областей початкового гена людини зародкового типу. Це виявлення пояснив низьку афінність 2Н1 до антигену.

Потім була розроблена детальна стратегія мутагенезу, спрямована виключно на послідовності гена, що кодує домени CDR3 областей VL (8 амінокислотних залишків) і VH (7 амінокислотних залишків) 2Н1 фрагмента антитіла scFv. Метод «Економного мутагенезу» (скорочено PM) (Balint, R. y Larrick J. W. 1993. Gene, 137:109-118) був використаний для того, щоб викликати мутації. В РМ був проведений аналіз мутованих послідовностей і мінімальні зміни, які могли змінити характеристики зв'язує ділянки антитіла оброблені на комп'ютері, беручи до уваги наявну інформацію з відомим иммуноглобулиновим послідовності, що надається базами даних загального користування. Використовуючи вироджені синтетичні олигонуклеотиди та полімеразну ланцюгову реакцію (ПЛР), РМ продукував мільйони нових мутантів для потрібного ділянки гена за дуже короткий проміжок часу.

РМ використовували незалежно на доменах CDR3 областей VL і VH 2Н1 scFv фрагмента �и дві великі бібліотеки scFv фрагмента антитіла (приблизно 5×108фрагментів), в яких зв'язують ділянки мутували в вищезазначені амінокислотні послідовності (Приклад 1). У бібліотеці, позначеної №1, вихідний 2Н1 scFv фрагмент антитіла області VL був збережений, пов'язаний з мільйонами нових областей VH, мутованих в CDR3. У бібліотеці, позначеної №2, вихідний 2Н1 scFv фрагмент антитіла області VH був збережений, пов'язаний з мільйонами нових областей VL, мутованих в CDR3.

Представлені фагом нові фрагменти антитіл scFv, характерні для двох бібліотек, були відібрані проти VEGF-А людини, одночасно використовуючи збільшення концентрації розчинного 2Н1 scFv, щоб сприяти виділенню нових scFv фрагментів антитіл з високою аффинностью до VEGF-А (Приклад 2).

Починаючи з нових клонів scFv фрагментів, представлених кожною з двох бібліотек, експериментальна оцінка їх відносного розпізнавання VEGF-А була здійснена за допомогою ELISA, по відношенню до 2Н1 scFv, також виявлених фагом (Приклад 2). Ці експерименти показали, яка з мутованих варіабельних областей VL і VH представляє чудові характеристики розпізнавання антигену та афінності до нових фрагментів.

Нові ідентифіковані вариабельние області були секвенировани для визначе, відібраних з бібліотеки №1, всі ці домени мали різні амінокислотні послідовності, як серед своїх, так і відносно вихідного VH 2Н1 scFv фрагмента антитіла (Приклад 2, таблиця 2). scFv фрагменти антитіл з кращим розпізнавання антигену були позначені як 3F3, 3E3 і 4D8, і містили нові області VH. 3F3 scFv, що містить VH, був позначений авторами винаходу, як Н6 (SEQ ID NO:1 для нуклеотидної послідовності і SEQ ID NO:4 для розшифрованої амінокислотної послідовності). 3E3 scFv, що містить VH, був позначений авторами винаходу, як Н5 (SEQ ID NO:2 для нуклеотидної послідовності і SEQ ID NO:5 для розшифрованої амінокислотної послідовності). 4D8 scFv, що містить VH, був позначений авторами винаходу, як Н7 (SEQ ID NO:3 для нуклеотидної послідовності і SEQ ID NO:6 розшифрованої амінокислотної послідовності).

Що стосується нових доменів CDR3 області VL з кращих scFv фрагментів антитіл, відібраних з бібліотеки №2 (Приклад 2, таблиця 3), автори визначили, що мутації в нових scFv фрагментах антитіл були об'єднані в окремі позиції щодо вихідного домену. У 3-х з 4-х scFv фрагментів з кращим розпізнаванням VEGF людини, 7 з 8 залишків CDR3 були збережені, з однією амінокислотою в п'ятій позиції,�ения зв'язку між сайтом зв'язування і антигеном, що могло бути вивчено надалі шляхом продукування додаткових замін в окремій п'ятій позиції. Нові scFv фрагменти антитіл, виявлені фагом пізніше були сконструйовані, беручи за основу типовий VL CDR3 з групи з кращим зв'язуванням, де послідовність CDR3, що кодує п'яту амінокислоту, була замінена для того, щоб продукувати амінокислоти P, E або D. Нові клони області VL, які були, таким чином, продуцировани, позначені L1, L2 і L3, відповідно.

З цих замін, одна, що містить амінокислоту D, виявилася єдиною, яка дала в якості результату scFv фрагмент антитіла з кращим розпізнавання антигену, відображений фагом, по відношенню до двох інших нових мутантів, всіх попередніх VL мутантів, і, безумовно, вихідного 2Н1 scFv (Приклад 3, таблиця 4).

Щоб продовжити поліпшення характеристик розпізнавання антигену, автори об'єднали далі VH області Н6, Н5 і Н7, встановлені як кращі з бібліотеки №1, з новим L3 області VL (SEQ ID NO:7 нуклеотидної і SEQ ID NO:8 для розшифрованої амінокислотної послідовності). Цим трьом новим scFv фрагментів антитіл, один раз відображеним фагом, позначеним як L3H6, L3H5 і L3H7, було проведено порівняння афінності до VEGF-А, від таблиця 5). Це дослідження показало, що три нових scFv фрагмента антитіл L3H6, L3H5 і L3H7, виявлених фагом, перевершують всі інші scFv. Серед цих трьох, L3H6 є єдиним, що показує найкраще IC50 в реакції інгібування, з вказівкою на те, що необхідно додавати більшу кількість розчинного 2Н1 scFv фрагмента в реакцію, щоб інгібувати середнє зв'язування L3H6 з VEGF людини.

У різних варіантах здійснення цього винаходу, гени, що кодують вариабельние області Н6 (SEQ ID NO:1), H5 (SEQ ID NO:2), H7 (SEQ ID NO:3) і L3 (SEQ ID NO:7) були використані для створення різних типів рекомбінантних антитіл: (а) розчинні scFv фрагменти, позначені як, scFv L3H6, scFv L3H5 і scFv L3H7, (b) розчинні фрагменти Fab, позначені як, Fab L3H6, Fab L3H5 і Fab L3H7, і (с) бивалетние антитіло-подібні молекули scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7.

Для створення рекомбінантних фрагментів антитіл scFvL3H6, scFvL3H5 і scFvL3H7, гени, що кодують області VH Н6 (SEQ ID NO:1), H5 (SEQ ID NO:2), H7 (SEQ ID NO:3), скомбіновані з областю VL L3 (SEQ ID NO:7), заповнені за допомогою линкерного сегмента в наступному порядку VH-лінкер-VL, використовуючи вектор pACR.1 (Приклад 5). Вектор pACR.1 сконструйований для експресії рекомбінантних білків у бактеріальній периплазме, і додає до С-кінця�ой гистидиновий домен, щоб полегшити очищення з допомогою метал-афінної хроматографії (скорочено IMAC) (Porath J. 1992. Prot. Expr. Purif. 3:263-281). Фрагменти антитіла scFv L3H6 (SEQ ID NO:9 для нуклеотидної послідовності і SEQ ID NO:10 амінокислотної послідовності), scFv L3H5 (SEQ ID NO:11 для нуклеотидної послідовності і SEQ ID NO:12 амінокислотної послідовності) і scFv L3H7 (SEQ ID NO:13 для нуклеотидної послідовності і SEQ ID NO:14 для амінокислотної послідовності), з очевидним молекулярною вагою приблизно 29 кДа в додецилсульфат-натриевом поліакриламідному гель-електрофорезі (скорочено SDS-PAGE), можуть бути отримані з середовища для культивування трансформованих бактерій, і легко очищається за допомогою IMAC.

Для створення рекомбінантних фрагментів Fab антитіл Fab L3H6, Fab L3H5 і Fab L3H7, гени, що кодують послідовності, що містяться у варіабельних областях Н6 (SEQ ID NO:1), H5 (SEQ ID NO:2), H7 (SEQ ID NO:3) і L3 (SEQ ID NO:7) було клоновано у вектор pFabHum-1 (Приклад 9). Плазміда pFabHum-1 є бицистронним вектором, сконструйованим для експресії фрагмента Fab з СН1 імуноглобуліну людини і константними ділянками З Lambda в бактеріальної периплазме. Вектор додає 6 гистидиновий і c-myc домен до С-кінця клонованої молекули. У цій плазмиде, області Н6, Н5 �mbda, приводячи в результаті до Fab фрагментів антитіл Fab L3H6 (з нуклеотидними послідовностями SEQ ID NO:15 і SEQ ID NO:16, які кодують амінокислотні послідовності SEQ ID NO:17 і SEQ ID NO:18), Fab L3H5 (з нуклеотидними послідовностями SEQ ID NO:19 і SEQ ID NO:20, які кодують амінокислотні послідовності SEQ ID NO:21 і SEQ ID NO:22) і Fab L3H7 (з нуклеотидними послідовностями SEQ ID NO:23 і SEQ ID NO:24, які кодують амінокислотні послідовності SEQ ID NO:25 і SEQ ID NO:26).

Фрагменти антитіл Fab L3H6, Fab L3H5 і Fab L3H7 експресують в Escherichia coli і очищають з допомогою IMAC з культурального середовища трансформованих бактерій, і мають очевидний молекулярний вага приблизно 50 кДа в неденатурирующем SDS-PAGE.

Бівалентні рекомбінантні антитіла scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 містять послідовності фрагментів антитіл scFv L3H6, L3H5 і L3H7, пов'язані в кожному положенні з 3'-послідовність, яка кодує 10 амінокислотний лінкер, за яким слід нуклеотидна послідовність, що кодує шарнір, домени СН2 і СН3 імуноглобуліну IgG1 людини. Згадані антитіла були отримані за допомогою клонування ПЛР-продуктів генів, що кодують вищевказані scFv фрагменти, у векторі pVSJG-HucFc (Приклад 10). Вектор pVSJG-HucFc був сконструбулина типу IgG1 людини, у клітинах ссавців. Молекули scFv2-Fc L3H6 (SEQ ID NO:27 для нуклеотидної послідовності і SEQ ID NO:28 для амінокислотної послідовності), scFv2-Fc L3H5 (SEQ ID NO:29 нуклеотидної послідовності і SEQ ID NO:30 для амінокислотної послідовності) і scFv2-Fc L3H7 (SEQ ID NO:31 для нуклеотидної послідовності і SEQ ID NO:32 для амінокислотної послідовності) були створені в супернатанте клітин СНО (клітини яєчників китайських хом'ячків), трансфицированних з відповідними плазмідами. Молекули scFv2-Fc, очищені за допомогою протеїну А чи протеїну G афінної хроматографії, показують очевидний молекулярний вага між 100 і 120 кДа в SDS-PAGE.

Метою справжнього винаходу є рекомбінантні антитіла, які є принципово новими по відношенню до інших антитілам і фрагментів антитіл, які розпізнають або нейтралізують VEGF-A людини, включаючи і ті, що отримані з джерела варіабельних областей 2H1 scFv фрагмента антитіла. Це відбувається тому, що метою цього винаходу є рекомбінантні антитіла:

(а) Мають принципово нові послідовності ДНК в їх змінної області CDR3. Це дозволяє відрізнити їх від інших антитіл проти VEGF-A, які описані други�SA 94:7192-7197; Asano M. et al. 1998. Hybridoma 17:185-190; Schaeppi, JM. et al. 1999. J Cancer Res Clin Oncol 125:336-342; Brekken, RA. et al. 2000. Cancer Res 60:5117-5124; Brekken, RA. and Thorpe, PE. 2001. J Controlled Release 74:173-181), або отримані зміною клітин людини вірусної трансформацією (US 5730977), модифікацією вже існуючих антитіл за допомогою методів генної інженерії (Lorna, G. et al. 2002. JNCI 94:1484-1493; Ferrara, N. et al. 2005. Biochem Biophys Res Comun 333:328-335), а також тих, які отримані з бібліотек фрагментів антитіл людини (Vitaliti A. et al. 2000. Cancer Res 60:4311-4314; Fuh, G. et al. 2006. J Товарbiol Chem 281:6625-6631).

Щодо областей VL і VH 2H1 фрагмента scFv-антитіла (WO2008/052489 A1), антитіла, описані в цьому винаході, також відрізняються. Області VH H6 (SEQ ID NO:4), H5 (SEQ ID NO:5) і H7 (SEQ ID NO:6) розрізняються по всьому 7 амінокислот CDR3 по відношенню до 2H1. Область VL L3 (SEQ ID NO:8) відрізняється за 3 з 8 амінокислот CDR3 по відношенню до 2H1.

b) Мають імунохімічної специфічністю до VEGF-A людини на відміну від тих фрагментів Fab антитіла людини, які отримані з інших бібліотек (Fuh, G. et al. 2006. J Товарbiol Chem 281:6625-6631), а також з тими, які в бевацизумабе. На відміну від антитіл, описаних у цьому винаході, бевацізумаб не здатний розпізнавати VEGF миші. Крім цього, бевацізумаб виявляє редукований VEGF-A, в той час як антитіла, описані в н�нантние антитіла володіють прекрасним і чудовим розпізнавання VEGF-A людини, по відношенню до 2H1 фрагмента scFv-антитіла і рекомбінантних антитілам, отриманими з 2H1 (WO2008/052489 A1).

(с) Фрагмент антитіла scFv L3H6 і рекомбінантні антитіла, отримані з нього (Fab L3H6 і scFv2-Fc-L3H6) розпізнають функціональний епітоп VEGF-A людини, який відрізняється від всіх інших, встановлених іншими антитілами, нейтралізуючими ефекти VFGF-A людини (Muller, Y. et al. 1997. PNAS USA 94:7192-7197; Muller, AY. et al. 1998. Structure 6:1153-1167; Schaeppi, JM. et al. 1999. J Cancer Res Clin Oncol 125:336-342; Brekken, RA. et al. 2000. Cancer Res 60:5117-5124; Fuh, G. et al. 2006. J Товарbiol Chem 281:6625-6631; WO2005012359; WO2008/052489 A1). Новий функціональний епітоп, виявлений в VEGF-A людини з допомогою нових рекомбінантних антитіл ScFv L3H6, Fab L3H6 і scFv2-Fc-L3H6, які описані у цьому винаході, має в якості незамінних амінокислот залишки К101, R103, E105 і Y25 (Приклад 11). Якщо ці амінокислоти заміщені, розпізнавання антитіл, описаних у цьому винаході, сильно утруднено.

Нові рекомбінантні антитіла, описані в цьому винаході, можуть зв'язуватися з розчинним VEGF-A людини, VEGF-A людини, адсорбованому на твердій поверхні, або VEGF-A людини, пов'язаному з клітинами людини або близькими до них, які продукують цей фактор, серед останніх, клітини, представлені в пухлинах людини, до�ически розпізнають ізоформи 121 і 165 VEGF-А людини, визначають VEGF миші і блокують взаємодію VEGF-A з рецептором VEGFR2, але не з рецептором VEGFR1. Останні дві властивості відрізняють нові рекомбінантні антитіла, описані в цьому винаході, від бевацизумаба і ранибизумаба.

Нові рекомбінантні антитіла, описані в цьому винаході, мають більш високу афінність до VEGF-A людини, ніж ті, що отримані з 2H1 scFv фрагмента антитіла, як показано в Прикладі 8. Отже, ці нові антитіла мають чудові характеристики по відношенню до ScFv 2H1 і антитілам, отриманими з 2H1, з тестів, які оцінюють: (а) блокування зв'язку VEGF і VEGFR2 (Приклад 7), (b) інгібування проліферації ендотеліальних клітин в культурі, в умовах стимуляції VEGF-A людини (Приклад 12), (c) інгібування підшкірного ангіогенезу у мишей, викликаного гранулами матригеля, які містять VEGF (Приклад 13), а також, інгібування росту пухлин людини, трансплантованих "голим" мишам (Приклад 14).

Визначення термінів, що використовуються у цьому винаході

Антигенсвязивающий ділянку

Цей термін описує частину антитіла, який специфічно взаємодіє з антигеном (або його частинами). Ділянка зв'язування антитіла формується, в основному, двома вариабла формується нековалентними взаємодіями варіабельних областей. Ділянка зв'язування антитіла може бути штучно стабілізовано за допомогою зчеплення двох варіабельних областей з пептидом, який не буде перешкоджати властивостями специфічного зв'язування антигену. Таким варіантом є фрагмент scFv. У природі, ділянки зв'язування антитіл з'єднані за допомогою нековалентних взаємодій варіабельних областей, посилених нековалентними взаємодіями CH1 і CL (Kappa та Lambda) константних доменів, а також дисульфидной зв'язком, встановленої між цистеїном, присутніх в CL, і іншим цистеїном, розташованому в шарнірному ділянці важкої ланцюга антитіла. Повні нативні антитіла мають два або більше однакових антигенсвязивающих ділянок.

Рекомбінантні антитіла

Цей термін описує імуноглобулін або його частини, продуковані повністю або частково в синтетичній формі, з допомогою методів рекомбінантної ДНК або штучного синтезу генів, зі специфічним розпізнавання антигену за допомогою одного або більше антигенсвязивающих ділянок (Gavilondo, J. Y Larrick. J. W. 2000. Biotechniques 29:128-136). Прикладами рекомбінантних антитіл є, так звані, химерні і гуманізовані антитіла, в яких генна інженерія використовується для связивлобулинов іншого виду. Серед рекомбінантних антитіл автори винаходу також знайшли фрагменти антитіл, продукованих за допомогою генної інженерії, які охоплюють один або більше антигенсвязивающих ділянок. Прикладами рекомбінантних фрагментів антитіл є: (i) фрагмент Fab, який містить иммуноглобулиновие домени VL, VH, CL і СН1; (ii) фрагмент Fd, що складається з VH доменів і СН1; (iii) фрагмент Fv, що складається з одного антитіла VL і VH; (iv) фрагмент scFv, де домени VH і VL цього антитіла скомбіновані в різному порядку (VH-VL або VL-VH) з пептидним лінкером, який дозволяє двом варіабельним областях зв'язати і сформувати антигенсвязивающий ділянку (Bird et al. 1998. Science 242:423-426; Huston et al. 1998. PNAS USA 85:5879-5883); (v) "ді-антитіла", які є полівалентними або полиспецифичними фрагментами, створеними за аналогією з scFv, але з коротким пептидним лінкером, який не дозволяє VH доменів і VL однієї і тієї ж молекули об'єднуватися в ділянку зв'язування, і останні повинні бути створені шляхом об'єднання двох або більше scFv, таким чином, забезпечуючи полівалентність (WO94/13804; Holliger P et al. 1993. PNAS USA 90:6444-6448); (vi) інші фрагменти, такі як dAb (Ward SE et al. 1989. Nature 341:544-546), ізольовані CDR, фрагменти F(ab')2, нанотела і бі-специфічні димери scFv (PCT/US92/09965; Holliger Рогут бути отримані з бібліотек антитіл, де великий спектр (репертуар) синтетичних або природних генів варіабельних областей виду комбінується випадковим чином, щоб продукувати специфічні зв'язування варіабельних областей, які потім виявляються у вигляді фрагментів антитіл на поверхні филаментного фага.

Також розглядається, що рекомбінантні антитіла є «антитіло-подібними» молекулами, продуцированними з допомогою методів генної інженерії, де фрагменти антитіл зібрані в константние ділянки антитіл. Наприклад, можливо сконструювати бивалентную «антитіло-подібну» молекулу (позначену в цьому описі, як scFv2-Fc) шляхом приєднання scFv до ділянки, утвореному шарніром, CH2, CH3 і у випадках доменів CH4 імуноглобуліну Fc. Залежно від частин, пов'язаних з цією конструкцією, а також наявності глікозилювання, позначена молекула може проявляти всі ефекторні функції, пов'язані з імуноглобуліном Fc. Як тільки вона експресується у відповідному господаря, молекула scFv2-Fc має два сайти зв'язування, які представлені двома однаковими scFv.

На закінчення, рекомбінантні антитіла також є молекулами, в яких вариабельние області легкої і важкої ланцюгів підлогу� шарнір, CH2, CH3 і у випадках CH4, для змінної галузі важкої ланцюга, а C Kappa або C Lambda для змінної галузі легкої ланцюга.

Еквівалентні варіанти антитіл

Еквівалентними варіантами антитіл є поліпептидні молекули, отримані з связиваний і маніпуляцій точних послідовностей їх варіабельних областей, які зберігають здатність специфічного розпізнавання антигену і розвитку ефектів на ньому, а також на його біологічні властивості. Ці поліпептидні молекули можуть приймати форму інших рекомбінантних фрагментів антитіл, подібних тим, в яких VL домен розташований перед лінкером та VH scFv доменами або іншими линкерними сегментами, відомий з існуючого рівня техніки, які використовуються, або продуцировани як F(ab')2, Fabc, Facb, димеризованих, тримерних або тетрамерних фрагментів scFv (Winter G, Milstein C. 1991. Nature 349:293-299; WO94/13804; de Haard, H et al. 1998. Adv. Drug Delivery Rev. 31:5-31). Також, коли полівалентні молекули продукують додаванням імуноглобуліну, отриманого з нуклеотидних послідовностей (Bestango M et al. 2001. Biochemistry 40:10686-10692). Еквівалентні варіанти антитіл також продукують, коли точні послідовності їх варіабельних областей містяться в биспецифических антитіл або виду. Всі ці генно-інженерні маніпуляції відомі фахівцям в даній області техніки.

Еквівалентні варіанти антитіл також розглядають ті молекули або варіанти, які продуцировани з допомогою, так званого CDR трансплантата, в якому CDR послідовність варіабельних областей штучно поміщена в чужоземне иммуноглобулиновую конструкцію і дана маніпуляція не впливає на здатність розпізнавати вихідний антиген і викликати біологічні та біохімічні ефекти.

Специфічність антитіла або його варіанти

Звернемося до ситуації, в якій антитіло або його фрагмент не буде в значній мірі зв'язуватися з іншими молекулами, відмінними від своєї специфічно зв'язує пари (антигену). Цей термін також застосовується до нагоди, де антигенсвязивающий ділянку є специфічним для характерного епітопу, виступає в числі родинних або неспоріднених антигенів, у цьому випадку, ділянка зв'язування антитіла буде здатний розпізнати декілька антигенів, які несуть згаданий епітоп.

Епітоп. Функціональний епітоп

Коли антиген великий, то антитіло може зв'язатися, виключно, з певною частиною антигену, яка позначається эпитопобразован первинної амінокислотною послідовністю або може бути конформаційних, що означає, що амінокислоти в антигені, які взаємодіють з ділянкою зв'язування антитіла структурно зібрані у третинну структуру білка, а не є обов'язковим продовженням своєї первинної структури. У разі білків, даний епітоп, за своєю природою, є дискретним, що характеризується групою специфічних амінокислот, які взаємодіють з тими антитілами через нековалентние зв'язку.

Функціональний епітоп є таким, який визначається експериментально за допомогою заміни специфічної амінокислоти в антигені, і ефект на втрату розпізнавання антигену (або його самого або його варіантів) встановлюється з допомогою імунохімічних методів.

Нові антитіла, описані в цьому винаході, є корисними для попередження неоваскуляризації хориоідеї на експериментальній моделі нижчих приматів, де пошкодження ока викликано лазерної фотокоагуляцией (Приклад 16).

Оскільки вони перешкоджають взаємодії між VEGF і рецептором VEGFR2, нові антитіла, описані в цьому винаході, впливають на здатність активованих ендотеліальних клітин та їх попередників у кістковому мозку проліферувати, а також на підтримання фізіологічної стаание також може порушувати інші біологічні функції, описані для VEGF, наприклад, його роль в якості негативного регулятора імунної відповіді (Chouaib S et al. 1997. Immunology Today 18:493-497).

Останнім те, що нові рекомбінантні антитіла, описані в цьому винаході, є корисними для розробки принципово нових терапевтичних методів для захворювань, які розвиваються через аномальну або надмірного ангіогенезу, серед яких можна знайти:

(а) Злоякісне новоутворення, мається на увазі первинні солідні пухлини та їх метастази; ці терапевтичні можливості включають, але не обмежуються: епідермоідні пухлини, злоякісні пухлини голови і шиї, колоректальні пухлини, рак простати, пухлини молочної залози, дрібноклітинний та недрібноклітинний рак легені, пухлини підшлункової залози, рак щитовидної залози, рак яєчників, пухлини печінки, саркому Капоші, неоплазії центральної нервової системи (нейробластома, гемангиобластома, менінгіома та метастази мозку), меланому, гастроинтестинальную карциному і карциному нирки, рабдомиосаркому, глиобластому і лейомиосаркому.

Рекомбінантні антитіла scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7, описані в цьому винаході, показали дію на ріст пухлин � цьому винаході, мають принципово новим розпізнаванням епітопу VEGF-А людини, вони відрізняються від інших антитіл анти-ангіогенних молекул своїм способом перешкоджати з'єднанню VEGF-А людину зі своїм рецептором VEGFR2, що змогло привести до різних терапевтичних ефектів в умовах in vivo. Документально відомо, що можливо продукувати різні терапевтичні ефекти в умовах in vivo, включаючи зменшення побічних ефектів у ракового хворого, з антитілами, продуцированними проти одного і того ж антигену, але, які розпізнають різні епітопи або мають різну спорідненість (Allan D. G. P. 2005. The Oncologist 10:760-761; Boland, W. K y Bebb, G. 2009. Expert Opin. Товарbiol. Ther. 9(9):1-8).

(b) Захворювання очей, такі як вікова макулодистрофія в ексудативною формою, неоваскулярная глаукома, а також діабетична та ретинопатія новонароджених. scFv L3H6 і молекули scFv2-Fc L3H6, описані в цьому винаході, проявили профілактичний і терапевтичний ефект (Приклад 16) при неоваскуляризації хориоідеї, викликаної опіками лазера на експериментальній моделі нижчих приматів, засвідчуючи про корисність цих антитіл у лікуванні вікової макулодистрофії (AMD) (Gaudreault, J. et al. 2005. Invest Ophthalmol Visual Sci 46:726-733; Costa, RA et al. 2006. Investing Ophthalmol Visual Sci 47:4569-4578) �ваються процеси, подібно астмі, респіраторному дистрес-синдрому, ендометріозу, а також атеросклерозу та набряку м'яких тканин.

(d) Інфекційні захворювання, подібно до гепатиту та саркомі Капоші.

(е) Аутоімунні захворювання, подібно діабету, псоріазу, ревматоїдного артриту і тиреоидиту.

(f) Ще кілька захворювань і станів, такі як, відторгнення трансплантованого органу, гемангіома і ангиофиброма.

Рекомбінантні антитіла, описані в цьому винаході, можуть бути пов'язані або конъюгировани з ферментом або його фрагментами, з модифікатором біологічної відповіді (BRM), з токсином або препаратом, а також радіоактивними ізотопами, які можуть бути додані до вихідної молекули, функціональні характеристики якої, відрізняються від її зв'язування з VEGF-A людини. Молекула scFv L3H6, описана в цьому винаході, була позначена радіоактивною міткою і введена "голим" мишам, несучим пухлини людини (Приклад 15). Було показано, що молекула депонировалась в пухлині і залишалася в морфологічної області навіть через три дні після введення. Таким чином, рекомбінантні антитіла, описані в цьому винаході, з'єднуючись з іншими терапевтичними засобами, можуть бути основою мето�иций. Антитіла, які хімічно або генетично пов'язані з терапевтичними радіонуклідами, токсинами, препаратами або BRM можуть впливати терапевтичним ефектом пов'язаного елемента на морфологічну область з аномальною концентрацією VEGF-A людини, а також на пухлину, або в безпосередній близькості від неї і, надавати терапевтичну дію. Кількість застосувань, частота і періодичність лікування залежать від природи та тяжкості хвороби і дані рішення є відповідальністю фахівців і лікарів, які ґрунтуються на тому, що добре відоме в даній області.

Іншим аспектом цього винаходу є використання описаних рекомбінантних антитіл для продукування фармацевтичних композицій, які можуть інгібувати ангіогенез, і можуть бути використані в лікуванні патологічних станів, пов'язаних з ним. Таке лікування включає призначення ефективного кількості описаних молекул людині.

Композиції, продуковані з рекомбінантними антитілами, описаними у цьому винаході, можуть бути призначені окремо чи в поєднанні з іншими лікарськими засобами, одночасно чи послідовно, все залежить від захворювання, яке лечический эксципиент, буфер, стабілізатор або носій та інші речовини, добре відомі фахівцям в даній області. Ці речовини не токсичні, не перешкоджають ефективності діючих активних речовин, і їх тип залежить від способу застосування, перорально, на слизову або парентерально, наприклад, внутрішньовенно. У кращому варіанті здійснення винаходу, композиції є композиціями з контрольованим вивільненням рекомбінантних антитіл по справжньому винаходу та інших діючих активних речовин в композиції.

Рекомбінантні антитіла, описані в цьому винаході, або їх еквівалентні варіанти продукуються шляхом експресії кодують нуклеїнових кислот. Внаслідок цього, послідовності нуклеїнових кислот, які кодують якісь з описаних рекомбінантних антитіл, також є частиною цього винаходу, як і способи експресії вищевказаних нуклеїнових кислот. У кращому варіанті здійснення винаходу, нуклеїнові кислоти, що кодують, переважно, але не тільки, нуклеотидні послідовності, наведені як приклад SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 (scFv L3H6, scFv L3H5 і scFv L3H7, відповідно); SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:23, SEQ IscFv2-Fc L3H7, відповідно).

Для рекомбінантної експресії молекул, описаних у цьому винаході або еквівалентних варіантів, повинні бути сконструйовані або вибрані відповідні вектори, які містять необхідні регуляторні послідовності, включаючи промотор, термінатор, енхансер і полиаденилированние послідовності, маркерні гени та інші, які вважаються придатними. Вектори можуть бути плазмідами.

КОРОТКИЙ ОПИС КРЕСЛЕНЬ

игура 1. Схематичне зображення плазміди pACR.1, використовуваної для створення розчинних scFv фрагментів в периплазме E. coli і супернатанте культури. Вектор має LacZ промотор, ділянка зв'язування рибосоми (RBS) і pelB сигнальний пептид (SP).

Фігура 2. (A) Електрофорез у 12% SDS-поліакриламідному гелі з результатами очищення scFv L3H6 фрагмента антитіла за допомогою IMAC, починаючи з супернатанту клітин E. coli BL-21, трансформованих плазміди pACR.1 scFv L3H6; зразки приготовані в завантажувальному буфері з бета-меркаптоэтанолом. Доріжка 1: маркери молекулярної ваги; Доріжка 2: элюция 250 мМ імідазолом, що показує смугу, відповідну фрагменту, розміром приблизно 29 кДа. (B) Вестерн-блоттінг репліки на електрофорезі, проведений з використанням анттов антитіл scFv L3H6, scFv L3H5 і scFv L3H7, що блокують доступ розчинних форм рецепторів VEGFR2 (KDR-Fc) і VEGFR1 (FLT-1-Fc) до VEGF-A людини, адсорбированному на твердій фазі. Виявлення пов'язаних розчинних рецепторів було проведено за допомогою анти-людських антитіл IgG, кон'югованих з HRPO (пероксидазою хрону). (A) Блокування KDR-Fc. Фрагмент scFv 2H1 був використаний в якості стандарту, а анти-HBsAg незв'язаного scFv в якості негативного контролю. (B) Блокування FLT-1-Fc. Анти-HBsAg незв'язаного scFv був використаний в якості негативного контролю, а Fab фрагмент люцентіс© (ранибизумаб) в якості контролю інгібування.

Фігура 4. Схематичне зображення плазміди pFabHum-1, використовуваної для створення розчинних фрагментів Fab в периплазме E. coli і супернатанте культури. Вектор має LacZ промотор, ділянка зв'язування рибосоми (RBS), pelB і p3M13 сигнальні пептиди (PS) у кожній экспрессионной касеті, разом з тим або іншим, константними доменами імуноглобуліну людини CH1 і З Lambda.

Постать 5. (A) Електрофорез у 12% SDS-поліакриламідному гелі з результатами очищення Fab L3H6 фрагмента антитіла за допомогою IMAC, починаючи з супернатанту клітин E. coli BL-21, трансформованих плазміди pFabHum-1 Fab scFv L3H6; зразки приготовані в завантажувальному буфері з бета-меркаптоэта-30 кДа. Доріжка 3: Вестерн-блоттінг репліки на електрофорезі, проведений з використанням анти c-myc антитіла 9Е10. Візуалізується тільки важка ланцюг Fab, яка містить c-myc домен. (B) Зразки, отримані в завантажувальному буфері без бета-меркаптоетанол (без скорочення). Доріжка 1: Видима смуга Fab, з розміром приблизно 50 кДа. Доріжка 2: Вестерн-блоттінг репліки на електрофорезі, проведений з використанням анти c-myc антитіла 9Е10.

Фігура 6. (A) Схематичне зображення плазміди pVSJG-HucFc, використовуваної для створення "антитіло-подібних" бівалентних молекул шляхом клонування гена scFv фрагмента між рестрикционними сайтами AfI II і Xba. (B) Схематичне зображення молекули типу, що продукується клітинами ссавців після трансфекції з цієї плазміди, як тільки ген scFv клонується в вектор.

Фігура 7. Зображення гідрофільних залишків (поверхня) VEGF-A людини, з використанням програми PyMol. Дві гомодимерние ланцюга зображені білим і сірим. У білій ланцюга незамінні амінокислоти K101, R103, E105 і Y25, пов'язані з эпитопом, пізнаваних рекомбінантними антитілами, описаними у цьому винаході, були виділені темно-сірим. Як можна побачити, вони визначають "кластер" або конформационную структтел (А) scFv L3H6, scFv L3H5 і scFv L3H7, і бівалентних рекомбінантних антитіл (B) scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 блокувати стимулюючий ефект VEGF-A людини на проліферацію ендотеліальних клітин вени пуповини людини (HuVEC). Фрагмент антитіла scFv 2H1 і бивалентное рекомбинантное антитіло scFv2-Fc 2H1 8.2, були використані в якості стандартів. На фігурі показані відносні значення проліферації по відношенню до додавання VEGF, а не антитіл (100%), коли зразки: фрагментів антитіл у концентрації 40 мкг/мл (A), або бівалентних молекул в концентрації 10 мкг/мл (В) додані до клітин. Негативними контролями служили незв'язані анти-HBsAg scFv та рецептор гуманизированного анти-EGF антитіла нимотузумаб. В якості контролю інгібування був використаний розчинний KDR-Fc. Кожен стовпець представляє середнє значення з трьох реплік, відібраних у групу, з відповідним стандартним відхиленням.

Фігура 9. Здатність бівалентних рекомбінантних антитіл scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 перешкоджати стимулюючого ефекту ангіогенезу VEGF-A людини, який міститься в імплантованих підшкірно гранулах матригеля, у C57BI/6 мишей. В якості негативного контролю використовували несвязанн�ка молекула scFv2-Fc 2H1 8.2 була використана в якості стандарту. В кінці експерименту вміст гранул матригеля обробили гемоглобіном, щоб визначити відносну кількість нових кровоносних судин. Графік відображає відносні значення концентрації гемоглобіну (100%) по відношенню до додавання VEGF, а не антитіл. Кожен стовпець представляє середнє значення для тварин, включених у кожну групу, з відповідним стандартним відхиленням.

Фігура 10. Вплив внутрибрюшинной ін'єкції бівалентних молекул scFv2-Fc L3H6, scFv2-Fc L3H5, scFv2-Fc L3H7 і scFv2-Fc 2H1 8.2 при 2,5 мг/кг дози ваги на зростання підшкірних пухлин, отриманих від інокуляції клітинної лінії A673 пухлини людини мишам "nude". Точки на кривих означають середні значення пухлини, оцінені для 5 тварин у групі. В якості негативного контролю використовували відповідний CB-Hep.1 моноклональне антитіло, в тій самій дозі.

ПРИКЛАДИ

Приклад 1. Конструкція фрагментів антитіл scFv бібліотек фагового дисплею, що містить мутовані вариабельние області

(а) Одержання мутованих варіабельних областей за допомогою полімеразної ланцюгової реакції (ПЛР)

Послідовності LVVRDTE і LLSYSGAR, відповідні CDR3 VH доменів і VLр синтетичних олігонуклеотидів (таблиця 1) був розроблений у відповідності з принципом «Економного мутагенезу» (PM, Balint, R. and Larrick, J. W. 1993. Gene, 137:109-118).

Таблиця 1
Дизайн та склад синтетичних олігонуклеотидів, використовуваних для мутагенезу 2H1 VH і VL варіабельних областей за допомогою ПЛР.
НазваПослідовність
VH (*)CATTGTCCCTTGGCCCCAGATT12G41G12A24A32A32C34TCTCGCACAGTAATACATGG
VH-BGACCACTCGAGTGCACAGCAGGTCCAGCTG
VH-FCAGGTGCACAGGCCTGAGGGGCCGAAGAGACGGTGACCATTGTCCCTTGGCCCCAG
VL(**)GTCCCTCCGCCGAACACCGGA24A42A22A43A13A43C34C34GCAGTAATACTCAGCCTCATC
VL-BGACCACTCGAGTCGACCAGGCTGTGGTGAC
VL-FCAGGTGCACAGCGGCCGCACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACC
(*)Суміш фосфорамидитов:
MixTCAG140%20%20%20%220%40%20%20%320%20%40%20%420%20%20%40%(**)Суміш фосфорамидитов:
MixTCAG1
46%18%18%18%
218%46%18%18%318%18%46%18%418%18%18%46%<зареєстровані scFv VH областей були використані праймери VH-B і VH, а для мутованих scFv VL областей - праймери VL-B і VL (див. таблицю 1). Фагмидний вектор pHG-1m (Rojas, G. et al. 2004 J. Immunol. Meth. 293:71-83), що несе ген "дикого типу" 2H1 scFv фрагмента антитіла (позначений 2H1-F; WO2008/052489 A1), використовували як ДНК-матриці в обох випадках і KOD термостабільний фермент (Novagen) згідно з інструкціями фірми-виробника. На першій стадії ПЛР були проведені 20 циклів ампліфікації. В кінці продукти реакції були незалежно один від одного очищені від агарозного гелю з використанням колонок QIAQuick (Qiagen) і элюировани водою. Концентрація ДНК була оцінена з допомогою електрофорезу з використанням ДНК-стандартів (NEB). Далі, проводили другу стадію ПЛР з використанням праймерів VH-B і VH-F для ампліфікації VH областей і праймерів VL-B і VL-F - для ампліфікації VL областей (див. таблицю 1). І в тому, і в іншому випадках, використовували 10 нг очищеної ДНК з відповідної першій стадії ПЛР. Той же термостабільний фермент (Novagen) був використаний у відповідності з інструкціями фірми-виробника, і проведено 15 циклів ампліфікації. Далі, продукти реакції були незалежно один від одного очищені від агарозного гелю з використанням колонок QIAQuick (Qiagen) і элюировани водою. Концентрація ДНК була оцінена з допомогою электрофидний вектор.

Зразки вектора 2H1-F і продукт очищеної ДНК з мутованих VH областей, розрізали за допомогою рестриктаз SfiI і ApalI (Fermentas і NEB), очищали від агарозного гелю з використанням колонок QIAQuick (Qiagen) і лігувати 1:1,5, відповідно, з використанням ДНК-лігази Т4 (NEB). Продукт лігування очищали за допомогою колонок QIAQuick (Qiagen) і элюировали водою.

Подібним чином, вектор 2H1-F і продукт очищеної ДНК з мутованих VL областей, розрізали за допомогою рестриктаз Sal I і NotI (Fermentas і NEB), очищали і лігувати, як було описано вище.

Электрокомпетентние клітини XL 1-Blue MRF' (1×109/мкг, Stratagene) були трансформовані незалежно з кожним перев'язуванням в 50 різних реакціях для кожної з них, висіяні також, незалежно, на великих чашках в 2xYT/ампицилин, і інкубовані протягом 24 годин при 37°C. Референсні чашки для визначення розміру бібліотеки показують, що обидві бібліотеки містять близько 5×108клітин. Бібліотека, що містить мутовані CDR3 VH областей і VL дикого типу з 2H1 scFv була позначена як бібліотека №1, у той час як інший, з мутований CDR3 VL областей і VH дикого типу з 2H1 scFv позначили бібліотека №2.

(с) Очищення ДНК з бібліотек, що містять мутовані вариабельние області

Бактеріальні кисокоочищенная ДНК була отримана з клітинного осаду за допомогою набору MaxiPrep (Qiagen) згідно з інструкціями фірми-виробника.

Приклад 2. Відбір фрагментів антитіл scFv відображених фагом, несучих мутантні вариабельние галузі важкої та легкої кіл з більш високою аффинностью до VEGF людини.

З бібліотек мутованих варіабельних областей була використана ДНК, щоб незалежно электропорировать клітини TG1 E. coli, які потім були інфіковані фагом-хелпером М13К07 для отримання фагів. Фаги очищали і зберігали в аликвотах при -20°С до подальшого вибору експериментів.

Для відбору, 2×1012фагів з кожної бібліотеки були розведені в PBS з 4% знежиреним молоком з 50 мкг/мл розчинної scFv 2H1 (WO2008/052489 A1), останній, щоб сприяти виділенню scFv фагом з високою аффинностью до VEGF-A людини, більш високою, ніж у scFv 2H1. Ці суміші були інкубовані, незалежно, протягом 5 годин з GST-VEGF людини (Morera, Y et al. 2006. Biotechnol. Appl. Biochem. 44:45-53), і іммобілізовані в иммунопробирках Maxisorp (Nunc). Иммунопробирки попередньо покривали 10 мкг/мл білка в PBS при 4°С протягом 16 годин, а потім блокували в PBS з 4% знежиреним молоком. Незв'язані фаги видаляли 20-кратними промиваннями в PBS з 0,1% Tween, c наступними двома додатковими промиваннями PBS. Потім зв'язані фаги элюировали в 100 ммоль/л розчину триэтиламина протягом 10 хв і незамедлител�ользовани в якості вихідного матеріалу для іншого відбіркового циклу. Цю методику повторювали два рази з дотриманням тих же умов. Фаги, элюированние з першого і другого відбіркових циклів, були використані для інфікування TG1 клітин, посіяних на чашках. Репрезентативні випадково відібрані бактеріальні колонії були виділені та інфіковані, щоб відтворити фаг у масштабі 96-лункового планшета (Marks, J. et al. 1991, J. Molec. Товарbiol. 222:581-587). Здатність таких фагових клонів, що відображають scFv на своїх білках III, пов'язувати GST-VEGF, оцінювали за допомогою ELISA. 96-лункові планшети Maxisorp (Nunc) покрили 10 мкг/мл GST-VEGF людини, і потім блокували PBS з 4% знежиреним молоком протягом 1 години при 22°С, з подальшими кількома промиваннями в PBS з 0,1% розчином Tween 20. Пов'язані фаги були виявлені анти-M13 антитілом, конъюгированним з пероксидазою (Amersham-Pharmacia) протягом 1 години при 22°С. Після декількох промивок, проводили реакції з розчином субстрату. Поглинання вимірювали при 492 нм на автоматичному фотометрі для мікропланшет (планшет-рідер).

Широкий зразок (19 і більше) клонів, виділених з кожної бібліотеки, які отримували вищі значення поглинання на ELISA, були незалежно оброблені для отримання нуклеотидних послідовностей, що кодують scFv (Macrogen, Корея).

У таблиці 2 �льної галузі важкої ланцюга (VH) від клонів, виділених з бібліотеки №1. Всі отримані послідовності (19) розрізнялися. У тієї ж самої таблиці, для кожного фага значення ІС50 описують концентрацію розчинного scFv 2H1 фрагмента, який необхідний, щоб інгібувати зв'язування фага в ELISA з VEGF на твердій фазі. Для цього 96-лункові планшети Maxisorp (Nunc) покривали 10 мкг/мл GST-VEGF, з подальшим блокуванням в PBS з 4% знежиреним молоком. Для того, щоб оцінити те ж саме кількість фагів з кожного клону, змішували з серійними розведеннями розчинної scFv 2H1 і інкубували в планшетах протягом 1 години при 22°С. Після декількох промивок в PBS з 0,1% Tween 20, VEGF-пов'язані фаги були виявлені за допомогою анти-M13 антитіла, кон'югованого з пероксидазою (Amersham-Pharmacia) протягом 1 години при 22°С. Після декількох промивок, проводили реакції з розчином субстрату. Поглинання вимірювали при 492 нм на автоматичному фотометрі для мікропланшет (планшет-рідері). Отримані значення поглинання, порівняно з концентраціями розчинної scFv 2H1 були відображені графічно і необхідна концентрація, щоб блокувати 50% (IC50) зв'язування, відображеного фагом scFv з іммобілізованим VEGF, була розрахована мкг/мл. Це значення є відносним показником аффинностакже показує значення ІС50 для вихідного відображеного фагом scFv 2H1, з метою порівняння. З нових клонів відображеного фагом scFv з мутований CDR3 послідовностями важкої ланцюга, раніше позначених, як 3F3, 3E3 і 4D8, мали найвищу відносну афінність до VEGF людини. Ці значення в 6-10 разів вище, ніж ті, що отримані для вихідного відображеного фагом scFv 2H1. Послідовності VH цих клонів були позначені H6 (SEQ ID NO:1 для нуклеотидної послідовності і SEQ ID NO:4 для розшифрованої амінокислотної послідовності), H5 (SEQ ID NO:2 для нуклеотидної послідовності і SEQ ID NO:5 для розшифрованої амінокислотної послідовності) і H7 (SEQ ID NO:3 для нуклеотидної послідовності і SEQ ID NO:6 розшифрованої амінокислотної послідовності).

Таблиця 2
VH CDR3 послідовності, і значення ІС50 для різних мутантів, відібраних з бібліотеки №1.
КлонVH CDR3 послідовністьІС50 (мкг/мл)
2H1 вихіднийLVVRDTE5,08
3F3QGTHNRK44D8PYATDTR31,98
3C4MVNRIPT28,97
3E1PSARDSQ21,16
3H2LTDPGHR19,62
2B12RSSRNAL21,05
3E12LTPTATK18,26
3D4LANGGNK16,26
3E2RVSPDTL15,30
2A7AIRGRGE15,79
3E10LLHSHGK15,07
3E9VNHGYSR15,02
3E4LAVRNPA13,51
4H39,06
3B10LFDTNNL7,94
4E11PGDNDTL5,28
4F2MTAPNIQ4,98

У таблиці 3 представлені розшифровані амінокислотні послідовності з CDR3 нуклеотидних послідовностей змінної галузі легкої ланцюга (VL) від клонів, виділених з бібліотеки №2. Аналіз послідовності 21 клону показав, що 13 з них розрізнялися, а 3 повторювали зразки, які об'єднувалися в групу з 5, 3 і 3 клонів, відповідно виявлених. У таблиці 3 представлені значення ІС50, що описують концентрацію вихідного розчинної scFv 2H1, який необхідний, щоб інгібувати зв'язування фага з VEGF людини на твердій поверхні, в методі ELISA, як було описано вище. У таблиці наведено значення ІС50 для вихідного відображеного фагом scFv 2H1, з метою порівняння. Найбільші значення ІС50 відповідають клонів, позначеним, як 1B1, 1H2, 2F6 і 1H3. Ці значення 23-30 разів вище тих, які були отримані для вихідного відображеного фагом scFv 2H1.

КлонІС50(мкг/мл)VL CDR3 послідовність
2H1(вихідний)5,08LLSYSGAR
1B1151,22RLSYALAR
1H2123,59RLSYSLAR
2F6119,38RLSYNLAR
1H3 (інші 2 клону з такою ж послідовністю)117,11ALSYNFTR
2D1O65,71RLYTSDYS
1D1258,88LLSYDRVR
1G457,68LLSYDRTR
2H846,56RLYTAAYH
1E9 (інші 2 клону з такою ж послідовністю)38,28LLAYPLTR
2A1035,81LLSYPFVR
2H1010,23LLSPDNHR
2F54,21ALSHDFSR

Приклад 3. Нові мутанти змінної області CDR3 легкого ланцюга.

Беручи до уваги послідовності і IC50, представлені в двох таблицях прикладу 2, був проведений аналіз з можливих нових мутацій, які створюють в CDR3 VL, для того, щоб в подальшому збільшити відносну спорідненість до антигену. Було вирішено зберегти послідовність RLSY(х)LAR з-за її консервативність у 3 з 4 кращих IC50 клонів і локалізувати мутації в п'ятому положенні цієї послідовності. Передбачувані нові амінокислоти для мутацій у цьому положенні були P, D або E, беручи до уваги характеристики цих специфічних залишків, а також те, виникнуть вони в даному положенні чи немає в інших клонах.

Двостадійна ПЛР, аналогічна описаній в Прикладі 1a, була використана для отримання цих нових мутантів, з використанням ДНК з клону 2F6, в качесбило проведено послідовне розрізання фагмидного вектора 2H1-F і нових ПЛР-фрагментів, методом, подібним до описаного в Прикладі 1b. Три нових рекомбінантних вектора були незалежно трансформовані і відібрано п'ять колоній, що представляють кожну трансформацію. ДНК з кожного зразка очистили і перевірили на наявність очікуваних мутацій. Була отримана високоочищенная ДНК і незалежно электропорировани клітини TG1 E. coli, які потім інфікували фагом-хелпером М13. Отримані фаги були очищені і перевірені, щоб визначити IC50, як описано вище в аналогічному прикладі.

Значення ІС50, що описують концентрації вихідного розчинної scFv 2H1, необхідні, щоб інгібувати 50% зв'язування фагів з VEGF людини на твердій фазі, визначили з допомогою тесту ELISA, аналогічного тому, який був використаний у вищезазначеному прикладі, і представили в таблиці 4 для кожного нового фагового клону. Значення для вихідного відображеного фагом scFv 2H1 також було включено з метою порівняння. Також представлені інші, описані раніше клони. Найбільше значення ІС50 відповідає новому клону L3, яке в 73 рази вище, ніж значення вихідного відображеного фагом scFv 2H1.

Таблиця 4
VL CDR3 послідовності і ІС50 для різних фагів="0">VL CDR3 послідовність
2H1(вихідний)4,89LLSYSGAR
L111,67RLSYPLAR
L2126,20RLSYELAR
L3358,10RLSYDLAR
1B1148,73RLSYALAR
1H2119,61RLSYSLAR
2F6114,88RLSYNLAR
1H3109,66ALSYNFTR

Приклад 4. Конструкція scFv фрагментів антитіл, що поєднує мутовані VH і VL вариабельние області для високої афінності до VEGF людини.

Було проведено розрізання рестриктазами і клонування, як описано вище, щоб отримати 3 нових фрагмента антитіл, які поєднують ген, що кодує VL, з клону L3 (позначеного однаковим чином, як L3; SEQ ID NO:7 нуклеотидн�вже згадувалися в прикладі 2, кодирующими важку ланцюг: H6 (SEQ ID NO:1 для нуклеотидної послідовності і SEQ ID NO:4 для розшифрованої амінокислотної послідовності), H5 (SEQ ID NO:2 для нуклеотидної послідовності і SEQ ID NO:5 для розшифрованої амінокислотної послідовності) і H7 (SEQ ID NO:3 для нуклеотидної послідовності і SEQ ID NO:6 розшифрованої амінокислотної послідовності). Электрокомпетентние клітини XL 1-Blue MRF' були незалежно трансформовані з цими 3 новими рекомбінантними плазмідами, а 5 незалежних колоній, з кожної клітини були відібрані і вирощені, щоб отримати ДНК. Після підтвердження відповідних послідовностей, ці плазміди були використані, щоб незалежно электропорировать клітини TG1 E. coli, які потім були інфіковані фагом-хелпером М13К07 для отримання фагів. Фаги очищали і використовували, щоб оцінити IC50 в ELISA, як зазначено в прикладі 2.

У таблиці 5 представлені значення ІС50 для кожного нового фагового клону, які описують концентрацію розчинного scFv 2H1 фрагмента антитіла, необхідного, щоб інгібувати зв'язування фага в ELISA з VEGF на твердій фазі, як було описано вище. Високе значення ІС50 і, внаслідок цього, краще розпізнавання антигену відповідає новому кло�ледовательности і значення ІС50 для нових scFv відображених фагом клонів, отриманих з комбінацій, по відношенню до відповідних вихідним клонів

Комбінація мутованих варіабельних областейCDR3 VL послідовністьCDR3 VH послідовністьПозначення нового клонаІС50 (мкг/мл)
L3+H6RLSYDLARQGTHNRKL3H6978,43
L3+H5RLSYDLARLVHRYRAL3H5940,24
L3+H7RLSYDLARPYATDTRL3H7890,11
Вихідні клониCDR3 VL послідовністьCDR3 VH послідовність
L3RLSYDLARLVVRDTE-350,45
49,67
3E3LLSYSGARLVHRYRA-34,56
4D8LLSYSGARPYATDTR-33,01

Приклад 5. Бактеріальна експресія та очищення фрагментів антитіл scFv L3H6, scFv L3H5 і scFv L3H7.

(а) Клонування фрагментів антитіл scFv L3H6, scFv L3H5 і scFv L3H7 у вектор pACR.1

Вектор pACR.1 являє собою плазміду, сконструйовану для експресії фрагментів антитіл в периплазму E. coli (фігура 1). Він має, в якості основних елементів, промотор LacZ, сигнальний пептид, сайти рестрикції NcoI і NotI для інсерції фрагмента, що кодує ген, домен, що кодує с-myc пептид, і послідовність, яка кодує 6 гистидинов, останні для очищення з допомогою IMAC. ДНК, відповідну фагмидам, яка кодує відображені scFv фрагменти антитіл L3H6, L3H5 і L3H7, використовували в якості матриці для трьох окремих ПЛР-реакцій. Дані методи були проведені з використанням ферменту ProofStart (Stratagene) згідно з інструкціями фірми-виробника. Синтетичні олигонуклеотидall">Таблиця 6
Синтетичні олигонуклеотиди для ампліфікації та модифікації scFv L3H6, що входять до складу фагмидного вектора, для клонування їх в плазмиде pACR.1.ОлигонуклеотидПослідовністьОліго 5'5...CTATTCTCCCATGGCACAG...3Оліго 3'5...TTCTGTATGAGGTTTTGC...3

Фрагменти очікуваного розміру (700 п. о.), отримані з трьох амплификаций, були очищені від 1% агарозного гелю з допомогою набору QIAquick Gel Extraction (QIAGEN). Різні ДНК були розрізані рестрикционними ферментами NcoI і NotI (Promega), і повторно очищені для лігування. Вектор pACR.1 був, таким чином, розрізаний та повторно очищений, а розрізані фрагменти були незалежно лигировани з вектором за допомогою ДНК-лігази Т4 (Promega). Продукти реакції лігування були використані для трансформації компетентних клітин E. coli (XL-1Blue; Stratagene) шляхом електропорації. Трансформовані клітини висівали на щільне селективну середу і культивували при 37°С. Використані методи широко відомі (Sambrook, Fritsch у Maniatis. 1989 Molecular Cloning, A Laboratory Manual, Second Edition).

Плазм�ві) гени шляхом рестрикційного аналізу, і плазміди з декількох колоній з трансформації відправляли на автоматичне секвенування ДНК з використанням праймерів, які гибридизуются за межами області клонування вектора pACR.1. Консенсусними послідовностями служили SEQ ID NO:9 для scFv L3H6, SEQ ID NO:11 для scFv L3H5 і SEQ ID NO:13 для scFv L3H7. Ці послідовності описували фрагменти, як кодують VH-лінкер-VL-с-myc-гистидини. Характерні для цих конструкцій плазміди, були позначені, як pACR.1-scFv L3H6, pACR.1-scFv L3H5 і pACR.1-scFv L3H7.

(b) Експресія scFv L3H6, scFv L3H5, scFv L3H7 в E. coli та очищення

Компетентні клітини E. coli BL21 були трансформовані плазмідами pACR.1-scFv L3H6, pACR.1-scFv L3H5 і pACR.1-scFv L3H7.

Трансформовані клітини висівали на щільне селективну середу і культивували протягом 16 годин при 37°С. Колонії, характерні для кожної конструкції, вирощували на рідкому поживному середовищі і при 600 нм оптичної щільності, прирівняної до 1, стимулювали протягом 12 годин додаванням 1 ммоль ізопропіл-β-D-тиогалактопиранозида (ІПТГ) в середу. Клітини центрифугували, а культури супернатантов піддавали діалізу у зв'язує буфері (50 ммоль NaH2PO4, 300 ммоль NaCl, рН 7-8) і наносили безпосередньо і незалежно в Agarose-NTA (QIAGEN). Після видалення забруднень промивкамощью 12% SDS-поліакриламідного гелю та Вестерн-блот, використовуючи в останньому моноклональне антитіло 9Е10, конъюгированное з пероксидазою, распознающее з-myc отриманого пептиду, який мають ці білки. Фігура 2 показує результати проведених методик у разі фрагмента антитіла scFv L3H6. Фігура 2А, доріжка 2, демонструє високу чистоту элюирования, що містить фрагмент антитіла, яке наблизилося до 29 кДа. Фігура 2В показує, що очищений білок розпізнається иммунохимически моноклональним антитілом 9Е10.

Приклад 6. Характеристика з допомогою ELISA імунохімічного розпізнавання різних варіантів VEGF фрагментами антитіл scFv L3H6, scFv L3H5 і scFv L3H7 порівняно з scFv 2H1.

96-лункові иммунопланшети Nunc Maxisorp покрили ізоформами 121 і 165 VEGF-A людини (Peprotech), VEGF миші (Peprotech) і P64K-VEGFKDR-(Morera, Y., et al. 2008. Angiogenesis 11(4):381-393) з концентрацією 1 мкг/мл в PBS протягом 16 год при 4°С. P64K-VEGFKDR-являє собою рекомбінантний білок, що виробляється в E. coli, що відноситься до VEGF людини, мутірованний в залишках 82, 84 і 86, щоб зменшити його взаємодія з рецептором VEGFR2 (KDR). Після блокування планшетів з PBS і 4% знежиреним молоком, додали фрагменти антитіл scFv L3H6, L3H5, L3H7 і 2H1, розведені в PBS з 4% знежиреним молоком, у концентрації 10 мкг/мл і інкубували в теченизой протягом 1 години. Після промивання, фрагменти, пов'язані з твердою фазою, були виявлені шляхом додавання розчину субстрату. Поглинання вимірювали при 492 нм на автоматичному фотометрі для мікропланшет (планшет-рідер). Незв'язаний анти-HBsAg scFv був використаний в якості негативного контролю (Ayala, М. et al. 1995 Biotechniques 18:832-842).

У таблиці 7 показано, що фрагменти антитіл scFv L3H6, scFv L3H5 і scFv L3H7 мають різне розпізнавання патерну по відношенню до scFv 2H1 і забезпечують більш високі значення поглинання (при 492 нм) (середнє значення за трьома лунках, взяте в якості стандарту, який представлений негативним контролем). Це вказує на більш високу спорідненість до антигену людини.

2,840
Таблиця 7
Значення поглинання (при 492 нм), що показують розпізнавання VEGF-A людини і миші фрагментами антитіл scFv L3H6, L3H5, L3H7 і 2H1.
ФрагментІзофрома 121 VEGF-A людиниІзофрома 165 VEGF-A людиниVEGF мишіP64K-VEGFKDR-
scFv 2H10,6910,6652,8891,4302,765
scFv L3H52,7762,8011,3902,611
scFv L3H72,5412,5121,1252,467
анти-HBsAg scFv0,0720,0780,0750,086

Приклад 7. Блокування взаємодії рецептора VEGF фрагментами антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1.

Використовуючи конкурентну систему ELISA, автори оцінили здатність очищених фрагментів антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1 блокувати взаємодію між рецептором VEGF людини та рекомбінантними рецепторами VEGF-VEGFR2 (KDR) і VEGFR1 (FLT-1). Підходи були засновані на інгібуванні зв'язування розчинних рецепторів KDR-Fc і FLT-1-Fc з VEGF-A людини, адсорбованому на твердій поверхні, шляхом додавання зростаючих концентрацій фрагментів.

96-лункові планшети Nunc Maxisorp покривали ізоформою 121 VEGF-A людини (Peprotech) в концентричні�танучими концентраціями (до 70 мкг/мл) очищених фрагментів антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1, або PBS з 4% молоком, а також 0,5 мкг/мл розчинних рецепторів KDR-Fc (R&D) або FLT-1-Fc (R&D). Незв'язані анти-HBsAg scFv були використані в якості негативного контролю (Ayala, M et al. 1995 Biotechniques 18:832-842), а Fab фрагмент люцентіс© (ранибизумаб) в якості контролю інгібування. Розчинні рецептори KDR-Fc або FLT-1-Fc, пов'язані з VEGF-A людини на твердій фазі, були виявлені анти-IgG антитілами людини, конъюгированними з пероксидазою (Sigma). У випадку з KDR-Fc (VEGFR2), як показано на фігурі 3А, фрагменти антитіл scFv L3H6, scFv L3H5 і scFv L3H7 блокують зв'язування рецептора з VEGF-A людини на твердій фазі, при чіткій дозової залежності. Значення інгібування для фрагментів антитіл scFv L3H6, scFv L3H5 і scFv L3H7 набагато вище тих, які спостерігалися в подібному експерименті зі стандартним scFv 2H1 фрагментом антитіла.

У випадку з FLT-1-Fc (VEGFR1), як показано на фігурі 3В, фрагменти антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1 не блокують зв'язування рецептора з VEGF-A людини, в той час як ранибизумаб блокує.

Приклад 8. Вимірювання афінності фрагментів антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1 до VEGF людини.

Зв'язує афінність фрагментів антитіл scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1 з VEGF людини була виміряна за допомогою BIAcore-X (BIAcore, Швеція). Сенсорниидрохлорид карбодіїміду (EDC) і N-гидроксисукцинимид (NHS) в відповідності з інструкціями фірми-виробника. Изоформу 165 VEGF людини (PeproTech) розвели до 5 мкг/мл до 10 ммоль/л ацетат-натрієвого буфера (рН 5,5), і ввели зі швидкістю потоку 5 мкл/хв, щоб отримати приблизно 290 одиниць відповіді зв'язаного білка.

Для кінетичних вимірювань серійні розведення препаратів очищених фрагментів scFv L3H6, scFv L3H5, scFv L3H7 і scFv 2H1, вводили в буфер HBS (10 ммоль/л HEPES, 150 ммоль/л NaCl, 3 ммоль/л ЕДТА, 0,005% поверхнево-активної речовини P20, рН 7,4) при 25°С і швидкості потоку 25 мкл/хв

Кінетичні параметри рівноважної константи дисоціації (KD) були розраховані з використанням програмного забезпечення BIA Evaluation 3.2. Дані по зв'язуванню наведені в цілому у відповідність з моделлю адсорбції Ленгмюра у відношенні 1:1. Отримані KDнаведені в таблиці 8.

Таблиця 8
Константи рівноважної дисоціації (KD)
scFvKD
2H14,57±0,13×10-7M
L3H62,61±0,11×10-8M
L3H54,21±0,18×10-8M

Приклад 9. Одержання і характеристика фрагментів антитіл Fab L3H6, Fab L3H5 і Fab L3H7.

(а) Клонування в вектор pFabHum-1 і секвенування

Фігура 4 являє собою схематичне зображення плазміди pFabHum-1, яка використовується для отримання розчинних Fab-фрагментів антитіл в периплазме і культуральному середовищі трансформованої Е. coli. Вектор має промотор LacZ, ділянка зв'язування рибосоми (RBS), послідовність сигнального пептиду (SP), ділянки клонування для змінної галузі легкої ланцюга (SaI I і Avr II), і послідовність, що кодує иммуноглобулиновий домен Cλ людини, за яким слідують інші RBS, SP, і ділянки клонування для змінної галузі важкої ланцюга (Ара LI і Bst EII), і, наступна за ними послідовність, що кодує иммуноглобулиновий домен СН1 людини, яка була розширена, щоб включити перший цистеїн шарнірної області Fc IgG1 людини. Варіабельна область СН1 важкої ланцюга експресується разом з 6-ти гистидиновим доменом для очищення з допомогою IMAC і с-myc пептидом для аналітичних цілей, які знаходяться на С-кінці, включеному в вектор.

Фагмидная ДНК, яка кодируе відповідні VH області. Після перевірки розмірів фрагментів в 1,5% агарозному гелі, три VH клонували окремо в pFabHum-1, попередньо розрізані тими ж ферментами. Як тільки клонування було перевірено за допомогою рестрикційного аналізу, проміжні плазміди (позначені як, pFab-RVH6, pFab-RVH5 і pFab-RVH7) були відтворена, очищені і піддані нової рестрикції з ферментами SaI I і Avr II. Після перевірки розмірів в 1,5% агарозному гелі, фагмид, який кодує фрагмент антитіла scFv L3H6, був розрізаний ферментами SaI I і Avr II, щоб отримати унікальний L3 області VL, який потім клонували в розрізані плазміди pFab-RVH6, pFab-RVH5 і pFab-RVH7. Як тільки клонування перевірили за допомогою рестрикційного аналізу, три отримані плазміди (позначені як, pFab L3H6, pFab L3H5 і pFab L3H7) були відтворена, очищені і піддані автоматичного ДНК-секвенированию. Послідовність ДНК, що кодує дві зрілі білкові ланцюги (без 6-ти гистидинового і с-myc доменів в важкої ланцюга), які складають фрагменти антитіл Fab L3H6, L3H5 Fab і Fab L3H7, представлені SEQ ID NO:15 і SEQ ID NO:16, SEQ ID NO:19 і SEQ ID NO:20, SEQ ID NO:23 і SEQ ID NO:24, відповідно. Розшифровані амінокислотні послідовності цих Fab фрагментів антитіл описані в SEQ ID NO:17 і SEQ ID NO:18, SEQ ID NO:21 і SEQ ID NO:22, SEQ ID NO:25 і SEQ ID NO:26, відпо�ани pFab L3H6, pFab L3H5 і pFab L3H7. Трансформації висівали на щільне селективну середу і культивували протягом 16 годин при 37°С. Репрезентативні колонії від кожної конструкції вирощували на рідкому середовищі і при 600 нм оптичної щільності, прирівняної до 1, стимулювали експресію Fab шляхом додавання ІПТГ до середовища. Клітини центрифугували і культури супернатантов піддавали діалізу у зв'язує буфері і наносили безпосередньо і незалежно в Agarose-NTA (QIAGEN). Після видалення забруднень промивки, пов'язані білки элюировали в 250 ммоль імідазолу.

Для электрофоретических досліджень були використані дві умови. У першому випадку, зразки інкубували в електрофоретичному буфері з бета-меркаптоэтанолом, щоб виробити зниження. У другому випадку, бета-меркаптоэтанол не використовували. На фігурі 5а показані результати очищення та Вестерн-блот (зі зниженими зразками і анти c-myc 9E10 антитілом для розвитку). У SDS-PAGE візуалізуються обидві ланцюга Fab (доріжка 2), з приблизним розміром 28-30 кДа. У Вестерн-блоттинге виявляється тільки Fab важкої ланцюга, оскільки вона містить с-myc (доріжка 3). На фігурі 5В, видно зразки, подані без зниження. SDS-PAGE показує смугу, відповідну Fab, з приблизними ра�ного антитіла 9Е10 (доріжка 2).

(с) Характеристика розпізнавання VEGF людини в ELISA фрагментами антитіл Fab L3H6, Fab L3H5 і Fab L3H7

Для очищених фрагментів антитіл Fab L3H6, Fab L3H5 і Fab L3H7 було оцінено розпізнавання VEGF-A людини в ELISA з використанням в якості стандарту Fab 2H1-32 (WO2008/052489 A1). 96-лункові иммунопланшети Nunc Maxisorp покрили ізоформами 121 і 165 VEGF-A людини (Peprotech), VEGF миші (Peprotech) і P64K-VEGFKDR-(Morera, Y., et al. 2008. Angiogenesis 11(4):381-393), в концентрації 1 мкг/мл в PBS протягом 16 годин при 4°С. Після блокування планшет в PBS з 4% знежиреним молоком, фрагменти антитіл Fab розводили в PBS з 4% знежиреним молоком, куди була додана концентрація 10 мкг/мл і інкубували протягом 1 години при 22°С. Після декількох промивок, додали моноклональне антитіло 9Е10, конъюгированное з пероксидазою, протягом 1 години. Після промивання фрагменти, пов'язані з твердою фазою, були виявлені шляхом додавання розчину субстрату. Поглинання вимірювали при 492 нм на автоматичному фотометрі для мікропланшет (планшет-рідері). Незв'язані Fab, отримані в результаті рестрикції анти-людського EGF рецептора антитіла Нимотузумаб, також позначені, як hR3 (Boland, W. К у Bebb, G. 2009. Expert Opin. Товарbiol. Ther. 9(9):1-8).

У таблиці 9 показано, що фрагменти антитіл Fab L3H6, Fab L3H5 і Fab L3H7 мають патерн Ѻам), приймаючи в якості стандарту ті, які напрацьовані негативним контролем, все, що свідчить про кращу афінності до антигенів людини.

Таблиця 9
Значення поглинання (492 нм), що вказують на розпізнавання VEGF-А людини і миші фрагментами антитіл Fab L3H6, Fab L3H5, Fab L3H7 і Fab 2H1-32.
ФрагментІзофрома 121 VEGF-A людиниІзофрома 165 VEGF-A людиниVEGF-A мишіP64K-VEGFKDR-
Fab 2H1-320,5890,6010,0910,704
Fab L3H62,5632,4561,1852,601
Fab L3H52,2452,3451,0872,507
Fab L3H72,2212,2011,0960,0750,0790,083

Приклад 10. Генерація та характеристика розпізнавання димеризованих молекул scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7.

(а) Генерація трансфектом, що виробляють антитіло-подібні молекули scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7

Щоб отримати антитіло-подібні молекули scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7, була проведена ПЛР з використанням плазмід pACR.1-scFv L3H6, pACR.1-scFv L3H5 і pACR.1-scFv L3H7 в якості матриць і синтетичних олігонуклеотидів, представлених у таблиці 10, для зміни послідовностей ДНК, які кодують ці фрагменти антитіл, щоб поєднати їх з наступним клонуванням. Даний метод проводили з KOD ДНК-полімеразою (Novagen) згідно з інструкціями фірми-виробника.

Таблиця 10
Синтетичні олигонуклеотиди, використовувані в ПЛР-ампліфікації для отримання scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7.
ОлигонуклеотидПослідовність
Оліго 5'5'... ACAGGGCTTAAGGAGGTGCAGCTGGTGCAGtable>

Послідовності ДНК, амплифицированние за допомогою ПЛР, було клоновано у вектор pVSJG-HucFc. Даний вектор (фігура 6А) був сконструйований для експресії в клітинах ссавців поліпептидного ланцюга, що містить, у наступному порядку: сигнальний пептид важкого ланцюга моноклонального антитіла миші, за яким йде послідовність, що кодує scFv, розділена 10-ю амінокислотами (виступають у якості спейсера), консенсусні послідовності, що кодують шарнір, домени СН2 і СН3 імуноглобуліну IgG1 людини. Це обумовлює те, що сигнальний пептид цієї поліпептидного ланцюга спрямований на ендоплазматичний ретикулум, де відбувається дімерізація через утворення ковалентних дисульфідних зв'язків в шарнірної області та природна зв'язок доменів СН2 і СН3. Шарнір, домени СН2 і СН3 утворюють Fc-ділянка імуноглобуліну людини, який зв'язується своїм N-кінцем з двома однаковими scFv, створюючи бивалентную антитіло-подібну молекулу (фігура 6В).

Фрагменти, амплифицированние за допомогою ПЛР, були розрізані рестрикционними ферментами AfI II і Xba I і незалежно клоновано у вектор pVSJG-HucFc. Автоматичне секвенування ДНК підтвердив ідентичність клонованих продуктів. Нуклеотидн�cFv2-Fc L3H7, описані в SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, відповідно, а розшифровані амінокислотні послідовності, описані в SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, відповідно.

Плазміди pVSJG-HucFc L3H6, pVSJG-HucFc L3H5 і pVSJG-HucFc L3H7 були очищені від вільних ендотоксинів з використанням набору Pure Yield Plasmid Midiprep Kit (Promega). Клітини СНО (яєчників китайських хом'ячків) (EACC Кат.№85050302) трансфицировали зазначеними плазмідами, використовуючи SuperFect (QIAGEN). Трансфектоми були відібрані у середовище, що містить G418, в якості маркера стійкості. Супернатанти клітинних культур, отримані з трансфектом колоній, зростаючих з G418, оцінювали за допомогою ELISA. 96-лункові планшети Maxisorp (Nunc) покривали VEGF121людини (Peprotech). Супернатанти, розведені в PBS з 2% знежиреним молоком, додавали в планшети і молекули scFv2-Fc анти-VEGF виявляли анти-Fc антитілами людини, конъюгированними з пероксидазою (Sigma). Трансфектому клітинних колоній з більш високим рівнем секреції молекул scFv2-Fc анти-VEGF, виявлену за допомогою ELISA, неодноразово клонували шляхом обмеженого розведення в середовищі, що містить G418, завжди перевіряючи її здатність до секреції за допомогою ELISA. Після принаймні двох послідовних клонувань, були отримані три стабільність�2-Fc L3H7.

(b) Очищення молекул scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 і оцінка зв'язуючої активності з VEGF людини методом ELISA

Трансфектоми клонів, що виробляють молекули scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 культивували на матрацах, розміром 162 см2у середовищі, що містить 0,5% ембріональної бичачої сироватки. Після високої щільності клітинної популяції був отриманий супернатант, який збирали і розводили у співвідношенні 1:1 до 0,1 М натрій-фосфатному буфері, рН 7,0, а потім молекули scFv2-Fc очищали за допомогою афінної хроматографії з використанням Protein A Sepharose Fast Flow 4 (Amersham). Різні молекули scFv2-Fc були незалежно элюировани в 0,2 М глициновом буфері, рН 4,0, і негайно нейтралізовані 1 М Трис рН 10,0. Після діалізу PBS, розрахували концентрацію білка шляхом вимірювання поглинання при 280 нм. Чистоту оцінювали за допомогою 12% SDS-PAGE. Зразки очищених молекул були перевірені в ELISA, як описувалося в (а), у порівнянні з неочищеним супернатантом, показуючи відповідну активність розпізнавання VEGF-A людини.

Приклад 11. Виявлення функціонального епітопи на VEGF людини, який розпізнається фрагментами антитіл scFv L3H6, scFv L3H5 і scFv L3H7.

Для отримання і відображення мурной структури молекули (PDB: 1FLT), розташування зон, для яких описано розпізнавання іншими антитілами і відмінності між VEGF людини і миші. Мутовані залишки представлені в таблиці 11.

>M10
Таблиця 11
Мутовані залишки VEGF121людини
МутантЗалишокПозиціяЗаміна
M1THR31TYR
M2ARG56GLU
M4GLN37ALA
M5GLU38ALA
M7GLU73LYS
M8LEU97THR
M9ARG56ALA
M11LYS101ARG
M13GLY58ALA
M14HIS27ARG
M15GLU72SER
M16GLY88SER
M17ASN100SER
M18VAL15ILE
M19GLY65ALA
M20THR71ALA
M22GLU103ALA
M23ARG105ALA
M24TYR25ALA
M25GLN22ALA

Мутації були отримані за допомогою ПЛР з використанням синтетичних олігонуклеотидів (таблиця 12), гибридизующихся з N - і С-кінцевими послідовностями, кодирующими VEGF121людини і в специфічних зонах, де мають бути введені очікувані мутації.

="0">M2-BAK: attgcagcagcccccgcattccatcaggggcacacagga
Таблиця 12
Синтетичні олигонуклеотиди, що використовуються для одержання мутантів VEGF121людини
VEGF-FOR: tctcacagtgcacaggcacccatggcagaaggaggagggc
VEGF-BAK: tatttaaagcggccgcccgcctcggcttgtcacatttttct
M1-BAK: ctggaagatgtccaccagatactcgattggatggcagta
M2-FOR: tcctgtgtgcccctgatggaatgcgggggctgctgcaat
M4-BAK: gatctcatcagggtactccgcgaagatgtccaccagggt
M4-FOR: accctggtggacatcttcgcggagtaccctgatgagatc
M5-BAK: ctcgatctcatcagggtacgcctggaagatgtccaccag
M5-FOR: ctggtggacatcttccaggcgtaccctgatgagatcgag
M7-BAK: ctgcatggtgatgttggatttctcagtgggcacacactc
M7-FOR: gagtgtgtgcccactgagaaatccaacatcaccatgcag
M8-BAK: catttgttgtgctgggtgaagctcatctctcctatgtgctggcct
M8-FOR: aggccagcacataggagagatgagcttcacccagcacaacaaatg
M9-BAK: cagggtactcctggaagatgtccaccagacgctcgattggatggc
M9-FOR: gccatccaatcgagcgtctggtggacatcttccaggagtaccctg
M10-BAK: attgcagcagcccccgcacgccatcaggggcacacagga
M10-FOR: tcctgtgtgcccctgatggcgtgcgggggctgctgcaatustify">M11-FOR: aggagagatgagcttcctacagcacaaccgttgtgaatgcagacc
M13-BAK: ctcgtcattgcagcagcccgcgcatcgcatcaggggcac
M13-FOR: gtgcccctgatgcgatgcgcgggctgctgcaatgacgag
M14-FOR: tatcagcgcagctactgccgcccaatcgagaccctggtg
M14-BAK: caccagggtctcgattgggcggcagtagctgcgctgata
M15-FOR: ctggagtgtgtgcccactagcgagtccaacatcaccatg
M15-BAK: catggtgatgttggactcgctagtgggcacacactccag
M16-FOR: cggatcaaacctcaccaaagccagcacataggagagatg
M16-BAK: catctctcctatgtgctggctttggtgaggtttgatccg
M17-FOR: atgagcttcctacagcacagcaaatgtgaatgcagacca
M17-BAK: tggtctgcattcacatttgctgtgctgtaggaagctcat
M18-FOR: cagaatcatcacgaagtgatcaagttcatggatgtctat
M18-BAK: atagacatccatgaacttgatcacttcgtgatgattctg
M19-FOR: ggctgctgcaatgacgaggcactggagtgtgtgcccactM20-FOR: ggcctggagtgtgtgcccgcagaggagtccaacatcacc
M20-BAK: ggtgatgttggactcctctgcgggcacacactccaggcc
M21-FOR: gagtgtgtgcccactgaggcatccaacatcaccatgcag
M21-BAK: ctgcatggtgatgttggatgcctcagtgggcacacactc
M22-FOR: ctacagcacaacaaatgtgcatgcagaccaaagaaagat
M22-BAK: atctttctttggtctgcatgcacatttgttgtgctgtag
M23-FOR: cacaacaaatgtgaatgcgcaccaaagaaagatagagca
23-BAK: tgctctatctttctttggtgcgcattcacatttgttgtg
M24-FOR: gatgtctatcagcgcagcgcatgccatccaatcgagacc
M24-BAK: ggtctcgattggatggcatgcgctgcgctgatagacatc
M25-FOR: aagttcatggatgtctatgcacgcagctactgccatcca
M25-BAK: tggatggcagtagctgcgtgcatagacatccatgaactt

Була проведена двостадійна ПЛР, щоб ввести мутації, використовуючи плазміду pVEGF (Ojalvo, A. G. et al. 2003. Electronic J. Biotechnol. 6, 208-222), що містить VEGF121людини, як матронцам (VEGF-FOR або VEGF-BACK), що з'єднуються в реакції з відповідними мутантними (М-BACK або М-FOR), в реакції з 15 циклів відповідно до інструкцій фірми-виробника термостабільного ферменту полімерази. На другій стадії ПЛР, суміш з двох попередніх реакцій стадії 1 була використана в якості матриці для кожного мутанта. Олигонуклеотиди, застосовані для введення мутації (M-BACK і M-FOR), розводили у співвідношенні 1:100 і використовували разом з олигонуклеотидами, комплементарними кінців (VEGF-FOR або VEGF-BACK). ДНК амплифицированних фрагментів були незалежно очищені за допомогою колонок QIAquick (Qiagen), а потім двічі розрізані ферментами ApaL I і Not-I HF (NEB) протягом 4 годин. Після очищення продуктів колонками QIAquick (Qiagen) і элюирования у воді, розрізані фрагменти ДНК було клоновано у вектор pHG-1m (Rojas, G. et al. 2004. J. Immunol. Meth. 293:71-83), попередньо розрізаний тими ж ферментами, оброблений фосфатазой (NEB) протягом 1 години і очищений від агарозного гелю з використанням тих же колонок. Гени, клоновані у вектор pHG-1m, відображалися на поверхні филаментних фагів у вигляді злиття з Білком III. В співвідношенні 1:5 вектор до фрагмента і лигазу Т4 (NEB) використовували в реакції лігування протягом 12 годин при 16°С.

Клітини TOP 10 F1' (Invitrogen) трансформували незалежні�протягом 24 годин при 37°С. Від кожного мутанта відбирали п'ять колоній і культивували в 5 мл культур, для того щоб очистити плазміди з допомогою набору plasmid Miniprep Kit (Qiagen). ДНК прослідковували і перевіряли наявність очікуваних мутацій. Був отриманий відповідний продукт для досліджень фаговой експресії.

Электрокомпетентние клітини TG1 E. coli були незалежно трансформовані з фагмидами, кодирующими кожен мутант. Фагмиди, що кодують дикий тип (WT) VEGF та непов'язаний білок (NR), також були включені в якості контролю в даний експеримент. Трансформовані клітини були інфіковані М13К07 для отримання фагів. Фаги були очищені і використані, щоб оцінити з допомогою ELISA розпізнавання кожного різними анти-VEGF антитілами: Бевацизумабом, поликлональними антитілами кролика (pAb) та фрагментом антитіла scFv L3H6. 96-лункові планшети покривали цими антитілами, у концентрації 10 мкг/мл в PBS протягом 16 годин при 4°С. Після блокування планшет в PBS з 4% знежиреним молоком, мутанти або VEGF дикого типу, відображені фагом, додавали до планшетів і інкубували протягом 1 години. Планшети були промиті PBS з 0,1% розчином Tween 20 та виявлено пов'язані фаги з анти-M13 антитілом, конъюгированним з пероксидазою (Amersham-Pharmacia) протягом 1 години. Планшети снb> і при 492 нм вимірювали поглинання на автоматичному фотометрі для мікропланшет (планшет-рідер).

У таблиці 13 представлена імунологічна реактивність, виражена середніми значеннями поглинання за трьома лунках для кожного анти-VEGF антитіла проти різних мутантів, VEGF дикого типу або незв'язаного білка, відображених фагом.

olspan="0">2,527
Таблиця 13
Імунологічна реактивність, виражена значеннями поглинання для кожного анти-VEGF антитіла проти різних мутантів і VEGF дикого типу, відображених фагом
ФагМутаціяPAbscFv L3H6Бев.
M1T31Y1,8761,8642,30
M2R56 E0,0880,0440,107
M4Q37A2,131,9141,431,9351,700
M7E73K0,8791,9121,599
M8L97T1,7682,2642,486
M9T31R2,301,9572,438
M10R56A0,1630,0430,180
M11K101R2,7620,2442,846
M13G58A2,8642,1092,547
M14H27R2,8612,4972,747
M15
M16G88S2,8702,0910,037
M17N100S2,8881,8992,663
M18V15I2,9112,6212,876
M19G65A2,8721,6472,552
M20T71A2,7021,6322,218
M21E73A2,7091,8092,486
M22E103A2,8190,0782,409
M23R105A2,863 y">Y25A2,8550,0442,558
M25Q22A2,8501,8592,702
WT - VEGF-2,6942,5042,668
NR-0,1800,0470,046

У таблиці 13 мутанти M2 (R56E) і М10 (R56A) виділені сірими клітинами, які викликають погіршення розпізнавання трьома перевіреними антитілами. Відомо, що ця амінокислота відіграє важливу роль у структурній цілісності VEGF людини та інших членів родини, таких як, PLGF і PDGF (Keyt, B. A. et. al. 1996. J. Товарbiol. Chem. 271:5638-5646). Вищевказані мутанти були використані в експерименті в якості внутрішнього контролю по відношенню до порушення структури молекули в цілому. В цій же таблиці 13, дані, відповідні мутантам: M11 (K101R), M22 (E103A), M23 (R105A) і M24 (Y25A), виділені жирним шрифтом і курсивом. Ці мутації помітно впливають на розпізнавання scFv L3H6 фрагментоуманизированним терапевтичним антитілом бевацизумабом, які були використані в цьому ж експерименті, не вплинули.

Ці результати показують, що новий функціональний епітоп VEGF людини розпізнається scFv L3H6 фрагментом антитіла та іншими рекомбінантними антитілами, отриманими від нього (Fab L3H6 і scFv2-Fc-L3H6); описаний у цьому винаході, безумовно, має, як незамінних амінокислот, залишки K101, R103, E105 і Y25.

На фігурі 7 представлено схематичне зображення поверхні залишків на гомодимере VEGF-A людини, отриманого за допомогою програмного забезпечення PyMol. На даному зображенні виділені темно-сірим в одному з двох гомодимеров амінокислоти K101, R103, E105 і Y25, які вкрай необхідні для розпізнавання антигену новими рекомбінантними антитілами, описаними у цьому винаході.

Графічне зображення гомодимери VEGF-A людини, отримане з використанням програмного забезпечення PyMol, показує, що амінокислоти K101, R103, E105 і Y25 встановлюють конформаційний кластер в області молекули, з хорошою гидрофильностью.

Приклад 12. Оцінка в умовах in vitro антипроліферативного ефекту різних рекомбінантних антитіл, які розпізнають VEGF людини, на моделі ендотеліальних клітин вени пуповини людини (HuVEC), стім -Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 визначали на моделі ендотеліальних клітин вени пуповини людини (HuVEC), стимульованих VEGF людини.

Антитіла scFv 2H1 і scFv2-Fc 2H1-8.2 (WO2008/052489 A1) були використані в якості стандарту, а scFv анти-HBsAg (Ayala M. et al. 1995. Biotechniques 18:832-842) і нимотузумаб (Центр молекулярної імунології у Гавані) в якості негативного контролю. Розчинний KDR-Fc 1 мкг/мл (Sigma) використовували в якості контролю інгібування.

В кількох словах, 3000 клітин HuVEC (PromoCell GmbH) висівали в кожну лунку 96-лункового культурального планшета (Costar), попередньо покритого 1% желатином (Sigma), в середовище RPMI 1640, доповнену 1% (об'єм, обсяг) ембріональної бичачою сироваткою (Gibco), і вирощували при 37°С у 5%2протягом 72 годин. Клітини стимулювали тільки 10 нг/мл VEGF-A людини (Peprotech; контроль зростання довільно встановили за 100%) або 10 нг/мл VEGF-A людини та 40 мкг/мл фрагментів scFv, або 10 мкг/мл бівалентних молекул. В кінці експерименту клітини фарбували 0,5% кристалічним фіолетовим в 20% метанолі. Планшети промивали водою і висушували на повітрі. Фарбування элюировали сумішшю розчину етанолу і 0,1 М цитрату натрію у співвідношенні 1:1 і вимірювали поглинання при 562 нм на планшет-рідері. Значення поглинання проекул, були оцінені у відсотках по відношенню до максимального контролю проліферації. Ці значення проліферації по відношенню до 100%, що свідчить про здатність цієї молекули інгібувати ріст клітин HuVEC, стимульованих VEGF людини. Як показано на фігурах 8А (для молекул scFv L3H6, scFv L3H5 і scFv L3H7) і 8В (scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7), рекомбінантні антитіла, що є метою цього винаходу, інгібують проліферацію клітин HuVEC при застосовуваних дозах. Інгібування, створене кожним типом рекомбінантних антитіл (scFv або бівалентної молекулою), перевершує те, яке справили в рівних дозах фрагмент антитіла scFv 2H1 або бівалентна молекула scFv2-Fc 2H1 8.2. Як правило, бівалентні молекули є більш ефективними у блокуванні доступу VEGF до клітинних рецепторів і, отже, інгібують проліферацію клітин HuVEC при більш низьких дозах.

Приклад 13. Оцінка в умовах in vitro антиангиогенного ефекту різних рекомбінантних антитіл, які розпізнають VEGF людини, на моделі мишей з імплантованими підшкірно гранулами матригеля.

В умовах in vivo антиангиогенний ефект бівалентних молекул scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 вивчався на експериментальній �єло-подібна молекула scFv2-Fc 2H1 8.2 (WO2008/052489 А1).

В даній моделі, ангіогенез викликається шляхом підшкірного введення (інокуляції) мишам C57BI/6 (CENPALAB, Гавана) екстракту білків позаклітинного матриксу (Matrigel, Becton Dickinson) в присутності проангиогенних факторів. Тварини були розділені на групи по 10 і ін'єктовані підшкірно в черевну область 500 мкл матригеля, що містить 200 нг VEGF людини (Peprotech), 100 мкг молекул, які підлягають дослідженню, включаючи незв'язані антитіла (CB-Hep.1, анти-HBsAg, Heber Biotec, Гавана) або 10 мкг KDR-Fc (Sigma), в якості контролю інгібування. Після закінчення шести днів тварин забивали, гранули матригеля витягували, і визначали вміст гемоглобіну в кожній методом Драбкіна з використанням набору Drabkin's reagent (Sigma) згідно з інструкціями фірми-виробника. Молекули scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7 значно інгібують (р < 0,001) васкуляризацію, викликану VEGF людини в гранулах матригеля, при зіставленні зі зниженням вмісту гемоглобіну. Отримані значення інгібування в 3 рази вище тих, які вироблені рекомбінантним антитілом scFv2-Fc 2H1 8.2, як можна бачити на фігурі 9.

Приклад 14. Оцінка в умовах in vivo протипухлинного ефекту рекомбінантних антитіл scFv2-Fc L3H6, scFv2<�саркоми людини.

Ангіогенез, спричинений пухлиною і деякими клітинами строми пухлини, має важливе значення для росту пухлини та її метастазування. Основним посередником цього проангиогенного ефекту є VEGF, вироблений цими клітинними елементами. Тому, моделлю, використовуваної для аналізу антиангіогенних речовин, є інгібування росту пухлини у тварин. Оскільки нові антитіла, описані в цьому патенті, розпізнають переважно VEGF людини, модель пухлинного росту у мишей здійснюється введенням пухлинних клітин людини изогенним бестимусним мишам (голі миші; nu/nu). В експерименті автори використовували 5 груп з 5 nu/nu бестимусних мишей лінії BALB/с (CENPALAB, Гавана), у віці 8-10 тижнів. Основні групи розподілили серед рекомбінантних антитіл scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7, рекомбінантної молекули scFv2-Fc 2H1-8.2 (WO2008/052489 A1) в якості стандартної, а мишачі моноклональні антитіла анти-HBsAg CB-Hep.1 (Heber Biotec, Гавана) в якості негативного контролю, все в дозі 2,5 мг/кг в PBS, рН 7,2. Мишам підшкірно вводили 1,5×107пухлинних клітин А673 людини (АТСС, CRL 1598) в праву спинну зону. Цей високої щільності клітинний инокулят разом з застосовуваної терапевтичної антитіл. Коли пухлини досягли обсягів 200 мм3, мишей розподілили випадковим чином на 5 груп по 5 тварин і почали лікування, як показано для кожної експериментальної групи. Введення проводилися внутрішньочеревно в обсязі 200 мкл, кожні 2 дні протягом 3 тижнів. Відстеження росту пухлин проводили за вимірюваннями найвищих (довжина) і низьких (ширина) діаметрів пухлини, з використанням електронного циркуля. Обсяги пухлин розраховували як: обсяг пухлини (мм3) = 0,52 × довжина (мм) x ширина2(мм). Обсяги пухлин протягом періоду спостереження порівнювали за допомогою однофакторного дисперсійного аналізу ANOVA і апостериорного тесту Бонферроні. Після встановленого періоду лікування, тварин забивали, пухлини видаляли хірургічним шляхом і проводили гістологічний аналіз з використанням гематоксиліну та еозину.

Як представлено на фігурі 10, всі тварини, інокульоване scFv2-Fc L3H6, scFv2-Fc L3H5 і scFv2-Fc L3H7, показали майже повний контроль над зростанням пухлини по відношенню до негативного контролю. Фігура також показує, що нові рекомбінантні антитіла, які є метою цього винаходу, перевершували по результативності щодо рекомбинантног�sub>2-Fc L3H5 і scFv2-Fc L3H7 мали значне зниження щільності судин, зменшення діаметра кровоносних судин, збільшення апоптозу пухлинних клітин, а також скорочення фігур мітозу.

Приклад 15. Здатність фрагмента scFv L3H6, міченого радіоактивним131I, депонуватись вибірково в області пухлини у "голих" мишей, інокульованих пухлинними клітинами лінії А673 рабдомиосаркоми людини.

Для того, щоб визначити здатність фрагмента scFv L3H6 депонуватися в області, що відповідає росту пухлинних клітин A673, даний фрагмент, і негативний контроль (мишачий анти-HBs В поверхневий антиген scFv; scFv-Hep.1; Ayala M. et al. 1995. Biotechniques 18:832-842) були помічені131I (Amersham, Великобританія) з допомогою методу йодування (Fraker PJ, Speck JC Jr. 1978. Biochem Biophys Res Comm 80:849-857) до кінцевих специфічних активностей 1,51 Мб/5 мкг і 1,55 Мб/5 мкг, відповідно.

Мічені продукти аналізували за допомогою тонкошарової хроматографії, щоб виявити включення в білок, описуючи значення радіоактивності 93 і 95%, відповідно. Здатність мічених продуктів виявляти їх відповідні антигени (людський VEGF та HBsAg) була вивчена в системі, де полістиролові иммунопробирки покривали ізоформою 121 реко�валі, і вводили в контакт із зразками радіоактивно мічених фрагментів відповідної специфічності, доводячи до кількостей, які можуть бути теоретично іммобілізовані на твердій фазі. Після инкубаций і промивок автори визначили, що тверда фаза здатна зв'язати 87,3% та 84,5% радіоактивності для scFv L3H6 і scFv-Hep.1, відповідно, показуючи, що метод радіоактивного мічення значно не змінив біологічної активності фрагментів.

Для дослідження биораспределения автори використали 30 nu/nu мишей. Тваринам підшкірно ввели 5×106пухлинних клітин людини культуральної лінії А673 в праву спинну зону. Коли пухлини досягли обсягів приблизно 300 мм3тварин розподілили випадковим чином на 6 груп по 5 тварин і почали лікування. Мишам у хвостову вену вводили радіоактивно мічений продукт (15 з scFv L3H6 і 15 з scFv Hep.1), а потім забивали в групах з п'яти, для кожного продукту, 24, 48 і 72 годин. Пухлина, селезінку, печінку, нирки, кишечник, м'язи, кістковий мозок і кров вилучали хірургічним шляхом або проводили забір зразка. Накопичення радіоактивності висловлювали як відсоток введеної дози на грам тканини. Калібрування проводили з використанням стандартного зразка введеної дози. Ра�иоактивности пухлина:кров, обчислене з вимірів, зроблених у цих тканинах. Експеримент показує, що між 24 та 72 годинами, фрагмент scFv L3H6 локалізована переважно в пухлинної тканини, на відміну від неспецифічного фрагмента scFv Hep.1. Ніякого специфічного накопичення радіоактивно міченого scFv L3H6 в інших тканинах відмінних від пухлини, виявлено не було, після закінчення 48 годин після введення.

Таблиця 14
Співвідношення радіоактивності пухлина:кров у "голих" мишей, трансплантованих клітинами A673 пухлини людини, які експресують VEGF людини
Молекула24 години48 годин72 години
scFv L3H625,532,046,5
scFv-Hep.10,41,00,7

Кожне співвідношення розраховували з середніх значень, отриманих із тканин, витягнутим у 5 мишей. Ці результати показують, що scFv L3H6 може специфічно локалізуватися в морф пухлина:кров у "голих" мишей, трансплантованих клітинами A673 пухлини людини, які експресують VEGF людини., і, внаслідок цього, є корисним, особливо, доставляти в цю область різні терапевтичні засоби, такі як, радіоактивний ізотоп або, в кінцевому підсумку, препарат або токсин.

Приклад 16. Попередження експериментальної неоваскуляризації хориоідеї (CNV) на моделі нижчих приматів з використанням фрагмента scFv L3H6 і бівалентної молекули scFv2-Fc L3H6.

В якості експериментальної моделі неоваскуляризації хориоідеї (CNV) автори використовували модель, описану Krzystolik з співавт. (Krzystolik M. G., et al. 2006. Acta Ophthalmol, 120:338-346). Шість макак (Macaca fascicularis, CENPALAB, Гавана) містили і зверталися з ними відповідно до Правил належної лабораторної практики поводження з тваринами установи (Good Laboratory Animal Practice guidance). Тваринам вводили анестезію при всіх процедурах у вигляді внутрішньом'язових ін'єкцій кетаміну гідрохлорид, ацепромазина малеат, і атропіну сульфату. Була також використана місцева анестезія з пропаракаина гідрохлорид. Анестезія перед вилущиванием і евтаназією проводилася внутрішньовенно фенобарбіталом натрію. Оболонки CNV були стимульовані в макулі фотокоагуляцией аргоновим лазером, засвідчивши� використані фотографування і флуоресцентна ангіографія для виявлення і вимірювання збільшення і характеристик поразок. Очі тварин перевіряли в різні дні, до і після застосування фрагмента, плацебо і процедури фотокоагуляції лазером, а також у кінці експерименту, який закінчувався вилущиванием і умертвінням тварин.

Тварини були розділені на дві групи по 3 у кожній, у відповідності з молекулами, що підлягають вивченню: scFv L3H6 фрагмента антитіла або бівалентної молекулою типу імуноглобуліну scFv2-Fc L3H6. Праве око кожної тварини вводили 300 мкг scFv L3H6 або scFv2-Fc L3H6, у відповідності з групою, в 50 мкл PBS шляхом интравитреальной ін'єкції, а ліве око було инъецирован тільки носієм. В очі вводили по 2 ін'єкції до впливу лазером (0 і 14 дні). На 21 день, на очі діяли лазером для стимулювання CNV. Ін'єкцію повторювали для кожного ока в день 2-ма - специфічним продуктом або носієм. Через три тижні після лазерної стимуляції (42 день), тваринам вводили интравитреальние ін'єкції, в цей раз все з фрагментом scFv L3H6 або молекулою scFv2-Fc L3H6, залежно від групи, щоб закінчити останній відповідної ін'єкцією на 56-й день.

На I стадії лікування (до 42-го дня), дослідження показали скорочення проявів 4-го ступеня уражень очей, де були застосовані scFv L3H6 або scFv2-Fc L�дупреждении CNV. На другій стадії лікування, коли у всі очі вводили scFv L3H6 або scFv2-Fc L3H6, автори виявили скорочення поразок 4-го ступеня, яке вказує на те, що фрагмент і бівалентна молекула також надають лікувальну дію на сформувалися пошкодження.

1. Рекомбинантное антитіло або його функціональний еквівалентний варіант, які специфічно розпізнають фактор росту ендотелію судин А людини (скорочено VEGF-A), які містять:
i) вариабельную область важкої ланцюга, кодовані нуклеотидної послідовністю, обраної з групи, що складається з послідовностей SEQ ID NO: 1, SEQ ID NO: 2 і SEQ ID NO: 3, і вариабельную область легкої ланцюга, кодовану нуклеотидної послідовністю SEQ ID NO: 7 або
ii) вариабельную область важкої ланцюга, обрану з групи, що складається з амінокислотних послідовностей SEQ ID NO: 4, SEQ ID NO: 5 і SEQ ID NO: 6, і вариабельную область легкої ланцюга з амінокислотною послідовністю SEQ ID NO: 8.

2. Рекомбинантное антитіло за п. 1, яке розпізнає функціональний епітоп фактора росту ендотелію судин людини (VEGF-A), в якому амінокислотні залишки K101, E103, R105 і Y25 є основними для взаємодії антитіло-антиген.

3. Рекомбинантное антитіло за п. 1 або 2, ко�их ізоформ VEGF-А людини.

4. Рекомбинантное антитіло по кожному з пп. 1-3, яке являє собою одноцепочечний Fv (scFv) фрагмент антитіла.

5. Рекомбинантное антитіло за п. 4, що:
i) кодується нуклеотидної послідовністю, обраної з групи нуклеотидних послідовностей, що складається з SEQ ID NO: 9, SEQ ID NO: 11 і SEQ ID NO: 13, або
ii) має аминокислотную послідовність, обрану з групи, що складається з SEQ ID NO: 10, SEQ ID NO: 12 SEQ ID NO: 14.

6. Рекомбинантное антитіло по кожному з пп. 1-3, яке являє собою фрагмент Fab антитіла.

7. Рекомбинантное антитіло за п. 6, що:
i) кодується парами нуклеотидних послідовностей, вибраних з групи, що складається з SEQ ID NO: 15 і SEQ ID NO: 16, SEQ ID NO: 19 і SEQ ID NO: 20, SEQ ID NO: 23 і SEQ ID NO: 24, для двох ланцюгів, або
ii) складається з пари амінокислотних послідовностей, вибраних з групи, що складається з SEQ ID NO: 17 і SEQ ID NO: 18, SEQ ID NO: 21 і SEQ ID NO: 22, SEQ ID NO: 25 і SEQ ID NO: 26, для двох ланцюгів.

8. Рекомбинантное антитіло по кожному з пп. 1-3 типу scFv2-Fc, де фрагмент scFv приєднується спейсером до шарнірної області, константним доменам СН2 і СН3 імуноглобуліну людини, які в своїй білковій формі ковалентно зв'язуються з іншого ідентичною поліпептидного ланцюгом з утворенням диммер �лайливої з групи, складається з нуклеотидних послідовностей SEQ ID NO: 27, SEQ ID NO: 29 і SEQ ID NO: 31; або
ii) має аминокислотную послідовність, обрану з групи, що складається з SEQ ID NO: 28, SEQ ID NO: 30 і SEQ ID NO: 32.

10. Рекомбинантное антитіло за п. 8, в якому Fc константних доменів імуноглобулінів людини складаються з типів IgG1, IgG2, IgG3 або IgG4.

11. Рекомбинантное антитіло по кожному з пп. 1-3, в якому нуклеотидні послідовності SEQ ID NO: 1, SEQ ID NO: 2 або SEQ ID NO: 3, кодують вариабельную область важкої ланцюга, і SEQ ID NO: 7, кодує вариабельную область легкої ланцюга, містять послідовність, яка кодує дві поліпептидні ланцюги, одну як вариабельную область важкої ланцюга, наступну за константними доменами СН1, шарніром, СН2 і СН3 імуноглобуліну людини IgG1, а другу як вариабельную область легкої ланцюга, наступну за константними доменами людини З kappa або З lambda.

12. Рекомбинантное антитіло за п. 11, в якому константние домени імуноглобуліну людини складаються з типів IgG2, IgG3 або IgG4.

13. Рекомбинантное антитіло по кожному з пп. 1-12, яке додатково конъюгировано з радіоактивним ізотопом, хімічною речовиною або біологічною речовиною.

14. Рекомбинантное антитіло по кожному з пп. 1-12, яке п�следовательности нуклеїнової кислоти, які кодують рекомбинантное антитіло по кожному з пп. 1-12.

16. Нуклеїнова кислота, що містить послідовності, що кодує рекомбинантное антитіло по кожному з пп. 1-12.

17. Фармацевтична композиція для імунотерапії патологічних утворень, пов'язаних із збільшенням судинної мережі, яка містить ефективне кількість рекомбінантного антитіла за пп. 1-12 і прийнятий фармацевтичний эксципиент, буфер, стабілізатор або носій.

18. Фармацевтична композиція з п. 17, відрізняється тим, що дозволяє контролювати вивільнення.

19. Застосування рекомбінантного антитіла за пп. 1-12 для одержання лікарського засобу для імунотерапії утворень, при яких розвивається ангіогенез, таких як злоякісні пухлини та їх метастази, гострі та хронічні запальні процеси, аутоімунні процеси, захворювання очей при віковій макулодистрофії.

20. Застосування рекомбінантного антитіла за пп. 1-12 для отримання радіофармацевтичних препаратів для діагностики злоякісних пухлин та їх метастазів в умовах in vivo за допомогою методів візуалізації.



 

Схожі патенти:

Інгібування axl сигналізації в антиметастатической терапії

Винахід відноситься до галузі біотехнології, конкретно до інгібіторів сигнального шляху AXL, і може бути використане в медицині. Отримують розчинну варіант поліпептиду AXL без трансмембранного домену AXL, який містить щонайменше одну модифікацію амінокислоти в положенні номер n, де n обраний 32, 72, 87, 92 або 127 або їх поєднання, де n+7 відповідає нумерації SEQ ID NO: 1 - послідовності AXL дикого типу, в якому зазначена модифікація підвищує спорідненість зв'язування поліпептиду AXL зі специфічно затримує зростання білком 6 (GAS6), яке, по меншою мірою, приблизно в 2 рази сильніше, ніж спорідненість поліпептиду AXL дикого типу. Поліпептид може бути злитий з Fc фрагментом і використаний в способі лікування, зниження або запобігання метастазування або інвазії пухлини у пацієнта-ссавця. Винахід дозволяє ефективно інгібувати сигнальні шляхи AXL/GAS6. 6 н. і 2 з.п. ф-ли, 15 іл., 6 табл., 3 пр.

Зв'язують протеїни, специфічні по відношенню до інсулін-подібним факторам зростання, і їх використання

Даний винахід відноситься до галузі імунології. Запропоновано повністю людське моноклональне антитіло, яке зв'язує інсуліноподібний фактор росту-II (IGF-II) і має перехресну реактивність IGF-I, а також його антигенсвязивающий фрагмент. Розглянуто молекула нуклеїнової кислоти, що кодує антитіло щодо винаходу, вектор і клітина-господар для експресії антитіла щодо винаходу. Описана фармацевтична композиція, а також кон'югати для лікування та діагностики злоякісної пухлини, застосування антитіла щодо винаходу в отриманні лікарського засобу та спосіб визначення рівня IGF-II і IGF-I в пробі пацієнта. Даний винахід може знайти подальше застосування в терапії раку. 8 н. і 8 з.п. ф-ли, 27 пр., 18 табл.

Антитіла проти фактора росту нервів (фрн), що володіють підвищеною стабільністю in vivo

Даний винахід відноситься до біотехнології і являє собою антитіла проти фактора росту нервів (ФРН). Справжній винахід також розкриває фармацевтичну композицію для полегшення болю, асоційованої з захворюванням або станом, при якому розвиток чи збереження болю опосередковано ФРН, що містить зазначені антитіла, а також набір для лікування пов'язаного з ФРН захворювання, такого як, наприклад, остеоартрит, нуклеїнові кислоти, що кодують важку або легку ланцюг антитіла, вектор експресії, що клітку-господаря для отримання зазначених антитіл, спосіб експресії зазначених антитіл проти ФРН, а також застосування зазначених антитіл в способі лікування болю і для одержання лікарського засобу для лікування болю, асоційованої з захворюванням або станом, при якому розвиток чи збереження болю опосередковано ФРН. Даний винахід дозволяє отримати антитіла проти ФРН, що характеризуються підвищеною стабільністю in vivo. 10 н. і 6 з.п. ф-ли, 7 іл., 13 табл., 8 пр.

Полиспецифические антитіла

Винахід відноситься до галузі біотехнології, конкретно до биспецифическим антитілам, і може бути використане в медицині. Конструюють антитіло, що містить одну з таких груп із шести послідовностей гипервариабельной області (HVR): (a) HVR-L1, що включає послідовність NIAKTISGY; (b) HVR-L2, що містить послідовність WGSFLY; (c) HVR-L3, містить послідовність HYSSPP; (d) HVR-H1, містить послідовність NIKDTY; (e) HVR-H2, що містить послідовність RIYPTNGYTR; та (f) HVR-Н3, містить послідовність WGGDGFYAMD; або (a) HVR-L1, що включає послідовність NIAKTISGY; (b) HVR-L2, що містить послідовність WGSFLY; (c) HVR-L3, містить послідовність HYSSPP; (d) HVR-H1, містить послідовність NISGTY; (e) HVR-H2, що містить послідовність RIYPSEGYTR; та (f) HVR-Н3, містить послідовність WVGVGFYAMD. Отримане антитіло специфічно зв'язує рецептор людського епідермального фактора росту 2 (HER2) і судинний ендотеліальний фактор росту (VEGF). Винахід відноситься також до виділеного фрагмента Fab зазначеного антитіла, полинуклеотиду, його кодирующему, вектора експресії, клітині-хазяїну, способу його одержання, а також до його застосування для лікування HER2-опосередкованих захворювань. Даний винахід дозволяє поЄ-ли, 65 іл., 16 табл., 8 пр.

Високоафінні людські антитіла до людського ангиопоэтину-2

Винахід відноситься до біотехнології. Запропоновано виділене людське антитіло або його антиген-зв'язуючий фрагмент, який специфічно зв'язується з людським ангиопоэтином-2 (hAng-2), але по суті не зв'язується з hAng-1, що характеризується наявністю CDR змінної галузі важкої та легкої ланцюга. Описана фармацевтична композиція на основі терапевтично ефективного кількості антитіла. Розкриті: варіанти застосування виділеного антитіла або його антиген-зв'язуючого фрагмента у виробництві лікарського засобу для застосування у лікуванні пацієнта, має різні захворювання, включаючи пухлину. Описані варіанти способу лікування різних захворювань. Використання винаходу забезпечує антитіло, високоспецифичное до людського ангиопоэтину-2 (hAng-2) з константою афінності близько 10-11, яке по суті не зв'язується з hAng-1, що може знайти застосування в лікуванні різних захворювань, пов'язаних з підвищеною активністю hAng-2. 6 н. і 13 з.п. ф-ли, 35 табл., 3 іл., 13 пр.

Биспецифические анти-vegf/анти-ang-2 антитіла

Винахід відноситься до галузі біотехнології та імунології. Описані биспецифические антитіла проти фактора росту судинного ендотелію людини VEGF і ангиопоэтина-2 людини ANG-2, способи їх отримання, фармацевтичні композиції, що містять зазначені антитіла, і їх застосування. 6 н. і 7 з.п. ф-ли, 26 іл., 15 табл., 19 пр.

Лікування розсіяного склерозу

Даний винахід відноситься до галузі біотехнології, конкретно до антагоністів гранулоцитарно-макрофагального колонієстимулюючого фактора (GM-CSF), і може бути використане в медицині. Винахід, що полягає у використанні антитіла, специфічного щодо GM-CSF у лікуванні або профілактиці розсіяного склерозу у пацієнтів з розсіяним склерозом, дозволяє затримати початок рецидивів розсіяного склерозу. 8 з.п. ф-ли, 5 іл., 8 пр.

Стабільні та розчинні антитіла, інгібуючі vegf

Винахід відноситься до області імунології та біотехнології. Представлені варіантні рекомбінантні антитіла проти VEGF людини, мають вариабельние галузі важкої та легкої ланцюгів, що містять гипервариабельне ділянки (CDR) антитіл кролика. Також представлені: виділені молекули нуклеїнових кислот, що кодують зазначені антитіла; вектор експресії, що містить зазначену молекулу нуклеїнової кислоти; і клітина-господар для експресії антитіла щодо винаходу, що містить зазначений вектор експресії. Описана фармацевтична композиція, що містить терапевтично ефективна кількість зазначеного антитіла і фармацевтично прийнятний носій. Винахід дозволяє розширити арсенал антитіл проти VEGF людини, отриманих від кролика. 7 н. і 17 з.п. ф-ли, 15 іл., 12 табл., 7 пр.

Моноклональні антитіла проти білка rgm а і їх застосування

Винахід відноситься до галузі біотехнології та імунології. Описані варіанти антитіл, що зв'язують молекулу GRM, а також їх антигенсвязивающие фрагменти, амінокислотні послідовності варіабельних областей яких представлені в матеріалах заявки. Представлена нуклеїнова кислота, що кодує зазначені антитіла. Запропоновано спосіб одержання білка, що зв'язує RGM, що включає культивування клітини-господаря в культуральному середовищі в умовах, відповідних для отримання зв'язуючого білка, здатного зв'язуватися з RGM, де клітина-господар містить вектор експресії, що містить виділену нуклеїнову кислоту, що кодує зазначене антитіло. Описана фармацевтична композиція для лікування захворювання, у якому активність RGM А чинить негативний вплив, що містить терапевтично ефективна кількість зазначеного антитіла і фармацевтично прийнятний носій. Запропоновано застосування зазначеного антитіла для одержання лікарського засобу, використовуваного для a) зниження зв'язування hRGM А з рецептором Neogenin хворого; або b) для зниження зв'язування hRGM А з ВМР-2 і ВМР-4 у хворого. Винахід дозволяє отримати антитіла проти GRM, які використовуються для лікування захворювань, зв &

Антитіло подвійної спрямованості в новій формі і його застосування

Винахід відноситься до галузі біотехнології та імунології. Представлено антитіло, яке являє собою нейтралізує антитіло проти VEGFR-2/KDR, гипервариабельние ділянки якого є ідентичними гипервариабельним ділянок антитіла TTAC 0001 проти VEGFR-2/KDR, злите зі зв'язуючим доменом ангиопоэтина 2, є лігандом Tie-2, для лікування раку за допомогою інгібування ангіогенезу. Також описані ДНК, що кодує зазначене антитіло; экспрессионний вектор, що містить зазначену ДНК; і клітина-господар CHO, трансформована зазначеним вектором, для отримання антитіла. Запропоновано спосіб отримання антитіла, що включає: інкубацію клітини-господаря, і виділення зазначеного антитіла з культуральної рідини клітини CHO. Описана фармацевтична композиція для лікування пов'язаного з ангиогенезом захворювання, що містить ефективне кількість зазначеного антитіла і щонайменше один фармацевтично прийнятний наповнювач. Винахід дозволяє отримати антитіло проти VEGFR-2/KDR, злите зі зв'язуючим доменом ангиопоэтина 2, яке може бути використане для ефективного лікування захворювання, пов'язаного з надмірною ангиогенезом. 6 н. і 7 з.п. ф-ли, 10 іл., 8 пр.
Up!