Рекомбінантна плазмидная днк pet40cmap/cgl, що кодує гібридний біфункціональний поліпептид cmap/cgl з властивостями високоактивної лужної фосфатази cmap і галактозоспецифичного лектину cgl, рекомбінантний штам e. coli rosetta(de3)/pet40cmap/cgl - продуцент гібридного бифункционального поліпептиду cmap/cgl та спосіб його одержання

 

Винахід відноситься до молекулярної біотехнології, зокрема до генетичної інженерії, і дозволяє отримувати мікробіологічним синтезом за оптимізованої технології новий гібридний біфункціональний поліпептид ComAP/CGL з властивостями високоактивної лужної фосфатази морської бактерії та лектин-зв'язує активністю галактозоспецифичного лектину мідії Crenomytilus grayanus, який може бути використаний для виявлення відмінностей у гликозилировании онкофетальних антигенів.

До теперішнього часу встановлено, що структура вуглеводних ланцюгів гликоконъюгатов, секретуються клітиною організму, в значній мірі залежить від типу патологічного процесу. Цілий ряд глікопротеїнів, названих онкофетальними антигенами (ОФУ), використовується в якості маркерів різного типу патологій. Одним із сучасних методів виявлення вуглеводного профілю клітинних гликоконъюгатов є використання вуглевод-зв'язуючих білків-пектинів, спроможних оборотно і вибірково зв'язуватися з певними вуглеводними структурами. Зокрема, такі глікопротеїни, як трофобласт-специфічний бета-1-глікопротеїн (ТБГ), раково-ембріональний антиген (РЕА), простата-специфічний антиген (ПСА), аль�науково пов'язаний з онкопатологією. Так, підвищений рівень ТБГ спостерігається як при нормально протікає вагітності, так і при онкопатології трофобласта - міхуровому заносі і хоріонепітеліомі [1]. Оскільки високий рівень ТБГ спостерігається в обох випадках, не представляється можливим провести чіткі відмінності між злоякісним захворюванням і вагітністю, що ускладнює своєчасну діагностику. РЕА секретується як нормальними епітеліальними клітинами кишечника, так і при аденокарциномах кишечника і поліпах [2-3], ПСА як при раку простати, так і при доброякісній гіперплазії [4], АФП - при раку печінки, цирозі або гепатиті [5], що часто не дозволяє поставити точний діагноз.

Раніше з морського безхребетного був виділений і охарактеризований галактозоспецифичний (Gal/GalNAc-специфічний) лектин з мідії Crenomytilus grayanus (CGL), а також для виявлення відмінностей у гликозилировании ОФУ, були розроблені методи твердофазного лектин-ферментного аналізу (ТЛФА) з використанням CGL [6-8]. Було показано, що лектини проявляють специфічність до вуглеводною ланцюгах, характерним для злоякісного росту, таких як Т-антиген (Galβ1→3GalNAc-O-Ser/Thr), Tn-антиген (GalNAc-O-Ser/Thr) та биссектний GlcNAc. Для розробки на їх основі методів ТЛФА були отримані кониспользованием CGL були протестовані сироватки вагітних жінок (у тому числі з загрозою невиношування) та сироватки жінок з онкопатологією. Виявлено достовірні відмінності між групами жінок з нормально протікає вагітністю і з загрозою невиношування, з одного боку, та між групами жінок з загрозою невиношування і онкозахворювання, з іншого боку [6]. При появі перших ознак патологічного процесу можна на ранніх стадіях диференціювати загрозу невиношування вагітності, обумовлену плацентарної недостатністю, від початку пухлинного процесу, що є вкрай важливим при встановленні первинного діагнозу.

Для виявлення відмінностей у гликозилировании ще одного ОФУ - раково-ембріонального антигену (РЕА) також був розроблений метод ТЛФА на основі CGL. Методами імуноферментного аналізу (ІФА) та ТЛФА проаналізовано сироватки онкологічних хворих з різною етіологією і сироватки здорових донорів. Результати експерименту показали суттєву різницю у зв'язуванні CGL з РЕА/РЕА-подібними антигенами з сироваток онкологічних хворих та здорових донорів. Середній рівень лектин-реактивних гликоформ РЕА в зразках з усіма видами онкопатологій був у 2-3 рази вище порівняно із середнім рівнем, визначеним для здорових людей [6].

Крім того, встановлено, що CGL є високочувстов симпатичної нервової системи. Мічений ферментною міткою CGL дозволяє визначати не тільки тіла нейронів Б-типу, але і їх немиелиновие аксони [7]. Вивчена також специфіка локалізації рецепторів муцинового типу в клітинах низкодифференцированной аденокарциноми товстої кишки людини. Виявлено основні типи локалізації цих рецепторів. Показано, що лектин CGL, мічений ферментною міткою, найбільш інтенсивно зв'язується з внутрішньоклітинними мембранами, цитоплазмою і секретом пухлинних клітин, що синтезують муцини [8].

Визначення концентрації лектин-пов'язаних структур в епітеліальному секреті є принципово новим підходом при виявленні злоякісних новоутворень. Проте такий аналіз вимагає підвищення ефективності поряд з простотою виконання методу. Це можливо при використанні методів генної інженерії. Методами молекулярного клонування була вперше встановлена структура нового галактозоспецифичного пектину CGL з мідії Crenomytilus grayanus [GenBank, код доступу JQ314213], що відкриває нове сімейство пектинів [9]. Відомий спосіб отримання високоактивного рекомбінантної лужної фосфатази морської бактерії CmAP [GenBank, код доступу ABD92772] [10].

Завдання винаходу - конструювання рекомбінантного штамЌ цільової високоочищений недеградированний гібридний біфункціональний поліпептид CmAP/CGL в препаративних кількостях, при збереженні як імуногенних властивостей галактозоспецифичного лектину мідії CGL, так і ферментативних властивостей високоактивної лужної фосфатази морської бактерії CmAP, використовуваної для кольорової візуалізації лектин-зв'язаних комплексів у лектин-ферментних методи ІФА і ТЛФА.

Поставлена задача вирішена шляхом конструювання рекомбінантної плазмідної ДНК pET40CmAP/CGL, кодує химерний поліпептид CmAP/CGL, і рекомбінантного штаму E. coli Rosetta(DE3)/pET40CmAP/CGL, що забезпечують індукований синтез з високим і стабільним виходом активного розчинної бифункционального білка CmAP/CGL, що володіє властивостями високоактивної лужної фосфатази морської бактерії CmAP і галактозоспецифичного лектину мідії CGL.

Технічний результат заявленого винаходу - отримання активного гібридного бифункционального поліпептиду CmAP/CGL з властивостями високоактивної лужної фосфатази CmAP і галактозоспецифичного лектину мідії CGL з високим виходом і рівнем очищення.

Плазміда pET40CmAP/CGL має 8192 пари підстав (п. о.) і характеризується наявністю NcoI/SalI < -фрагмент плазміди pET-40b(+) (Novagen) і послідовності фрагмента ДНК розміром 2028 п. о., що містить химерний ген лужної фосфатази CmAP (N-кінець гібридної молекули) і галакто ентерокінази.

На малюнку 1 представлена фізична карта плазміди pET40CmAP/CGL і область плазміди, відповідальна за експресію гібридного білка CmAP/CGL. Нуклеотидна послідовність фрагмента плазміди pET40CmAP/CGL, фланкированная сайтами NcoI і SalI<, містить послідовність структурного гена CmAP, відповідну відкритої рамки зчитування для білка CmAP, послідовності з'єднує лінкера (G4S)3EL сайту ентерокінази D4K, послідовність структурного гена CGL, відповідну відкритої рамки зчитування для білка CGL (SEQ ID N 1).

Рекомбінантний штам E. coli Rosetta(DE3)/pET40CmAP/CGL отримано трансформацією клітин E. coli Rosetta(DE3) (Novagen) плазміди pET40CmAP/CGL з використанням традиційної генно-інженерної технології [11].

Рекомбінантний штам E. coli Rosetta(DE3)/pET40CmAP/CGL характеризується наступними ознаками.

Культурально-морфологічні ознаки.

Клітини штаму утворюють великі круглі, з рівними краями, опуклі колонії до 5 мм в діаметрі, поверхня колоній гладка, консистенція слизова. Пігмент накопичується. Грамотрицательни, спор не утворюють, капсули не мають. Колонії добре ростуть на простих поживних середовищах (LB). При зростанні в рідких середовищах утворюють інтенсивну рівну каламуть.

Фізико-биологическм не має желатиназной активністю, не ферментує лізин; розщеплюють глюкозу, лактозу, маніт, сахарозу до кислоти і газу. Має мутацію в гені lac, забезпечує контроль рівня експресії, а також трансляцію рідкісних кодонов. Оптимальною для росту є температура 37°С, а для продукції білка CmAP/CGL - 16°С.

Стійкість до антибіотиків.

Клітини штаму характеризуються стійкістю до хлорамфеніколу (34 мкг/мл) і канаміцину (25 мкг/мл).

Патогенність і токсичність.

Рекомбінантний штам E. coli Rosetta(DE3)/pET40CmAP/CGL не патогенів і не токсичний для теплокровних тварин.

Штам зберігається звичайним способом в суспензії з гліцерином (30%) при -20°С.

Заявляється спосіб отримання гібридного бифункционального білка CmAP/CGL полягає в культивуванні клітин штаму E. coli Rosetta(DE3)/pET40CmAP/CGL в рідкому поживному середовищі LB протягом 12 год при 16°С, потім бактеріальні клітини осаджують центрифугуванням, суспензію клітин дезінтегруючі в буфері, далі екстракт центрифугують, потім надосадову рідину поміщають на колонку з іонообмінної смолою, далі элюируют білок, потім білковий елюатів поміщають на колонку з металлоаф інною смолою, далі активні фракції концентрують на іонообмінній смолі і виділяють цільовий продукт гель-фільтрацією.

а складає не менше 10 мг рекомбінантного білка з 1 л культури з питомою активністю лужної фосфатази не менше 10000 од/мг білка та імуногенними властивостями галактозоспецифичного лектину, характерними для природного аналога CGL з мідії [6-9].

Рекомбінантний гібридний біфункціональний білок CmAP/CGL має відносну молекулярну масу 105,5 кДа, включаючи плазмідний шаперон DsbC з молекулярною масою 32,5 кДа, широкий діапазон значень температури (25-37°С) і рН (7,5-9,5) для виявлення фосфатазной активності та афінних властивостей лектину. Плазмідний шаперон Dsb не впливає на функціональність обох частин химери CmAP/CGL. В молекулі CmAP/CGL передбачено наявність сайту ентерокінази між функціональними модулями для видалення лужної фосфатази з реакції при необхідності.

Використання галактозоспецифичного лектину мідії в складі гібридного бифункционального поліпептиду CmAP/CGL з активністю лужної фосфатази дозволяє скоротити стадії та час лектин-ферментного аналізу, які раніше були потрібні для отримання кон'югатів лектину і ферменту.

На малюнку 2 представлені результати гемаглютинації та лектин-ферментного аналізу (ІФА), проведені з гібридним бифункциональним поліпептидом CmAP/CGL, отриманими від різних рекомбінантних колоній трансгенного штаму Е. coli Rosetta(DE3)/pET40CmAP/CGL.

Для гемаглютинації брали несорбирующий 96-лунковий планшет з U-образними лунками. Зразок, содер�ениям доливали по 50 мкл 2% еритроцитів людини групи О (I). Протягом години спостерігали реакцію гемаглютинації. ІФА проводили на микропланшете, сенсибилизированном муцином, із застосуванням гібридного бифункционального поліпептиду CmAP/CGL, отриманого від колоній №3 і 6, відібраних за результатами геммаглютинации (фіг.2). Рівень афінності рекомбінантного гібридного бифункционального поліпептиду CmAP/CGL визначали по концентрації лектин-зв'язаних комплексів з муцином (по осі X). Візуалізацію пектин-зв'язаних комплексів здійснювали методом вимірювання фосфатазной активності рекомбінантного гібридного бифункционального поліпептиду CmAP/CGL (по осі Y).

Суттєвими перевагами заявляється способу отримання гібридного бифункционального поліпептиду CmAP/CGL є:

використання рекомбінантного штаму-продуцента E. coli Rosetta(DE3)/pET40CmAP/CGL, що дозволяє отримувати при біосинтезі велика кількість високоактивного бифункционального гібридного білка CmAP/CGL;

- використання нескладної трехстадийной хроматографічного очищення рекомбінантного білка, що дозволяє отримати чистий гібридний поліпептид CmAP/CGL за короткий час і з малими втратами.

Спосіб отримання функціонально активного гібридного поліпептиду CmAP/CGL на основі використання химстрируется наступними прикладами.

Приклад 1. Конструювання плазміди pET40CmAP/CGL.

Рекомбинантную плазміду pET40CmAP/CGL, що містить химерний ген, що кодує повнорозмірну лужну фосфатазу CmAP і повнорозмірний галактозоспецифичний лектин CGL, що з'єднуються через гнучкий лінкер (G4S)3ELD4K, фланковані сайтами рестрикції NcoI і SalI<, конструюють на основі комерційної плазміди pET-40b(+) (Novagen).

Фрагмент ДНК, що містить химерний ген гібридного поліпептиду CmAP/CGL, отримують в два етапи. На першому етапі проводять полімеразну ланцюгову реакцію з використанням плазміди 40Pho в якості матриці для отримання гена лужної фосфатази CmAP і праймерів X-PhoN_F і Pho40X-Мікрон-R, де X-PhoN_F - праймер, специфічний по відношенню до N-кінцевої послідовності CmAP, що включає сайт для рестриктази NcoI; Pho40X-Мікрон-R - зворотний праймер, специфічний по відношенню до С-кінцевої послідовності CmAP, що включає полинуклеотид, що кодує лінкер (G4S)3і сайт рестрикції Sad:

X-PhoN_F: 5'-TATTCCATGGCAGAGATCAAGAATGTCATTCTGAT-3'

Pho40X-Мікрон-R: -5'-TTAAGAGCTCAGAACCACCACCACCAGAACCACCACCACCAGAACCACCACCACCCT TCGCTACCACTGTCTTCAGATACTGTCCT-3'.

Цю реакцію проводять в наступних умовах: 10× Encycio буфер, 50× суміш полимераз Encyclo ("Encyclo PCR kit", Евроген, Москва), 50× суміш dNTP (10 µм кожного), суміш праймерів (5 µМ кожного), 20 нг ДНК. Процес амплиф�икации ПЛР-продукт очищають электрофоретически в 1% агарозному гелі. Фрагмент (1 мкг) обробляють рестриктазами NcoI та Мікрон в оптимальному буфері (Fermentas) протягом 3 годин, потім ферменти видаляють з реакційної середовища за стандартною методикою фенолом (1:1) [11]. У водну фракцію, що містить фрагмент, додають 1/10 обсягу 0,3 М ацетату Натрію, рн 5,2, і 1/2 обсягу изопропанолового спирту і залишають на -20°С протягом 30 хв. Потім центрифугують при 14000 об/хв протягом 20 хв, осад промивають 75% етанолом і висушують при кімнатній температурі. Осад розчиняють у 20 мкл.

2 мкг плазмідної ДНК рЕТ-40b(+) обробляють рестриктазами NcoI та Мікрон у відповідності з методикою, описаною вище, і з отриманого гідролізату виділяють векторну частина плазміди в 1% гелі легкоплавкої агарози.

Отриманий фрагмент гена CmAP і векторну частина плазміди рЕТ-40b(+) зшивають за допомогою лигазной реакції в 50 мкл буфера для лігування згідно інструкції (Fermentas). 10 мкл реакційної суміші використовують для трансформації компетентних клітин E. coli Rosetta(DE3). Трансформантів висівають на LB-агар, що містить 25 мкг/мл канаміцину. Після інкубування протягом 16 год при 37°С клони отсевают, виділяють плазмидную ДНК і аналізують на наявність мутацій за допомогою автоматичного секвенування. Відбирають плазмидную ДНК pET40CmAP, який містить по�користуванням к-ДНК мідії Crenomytilus grayanus і пари праймерів CGL-exp40X_dir і CGL-exp40_rev, включають сайти для рестриктаз Sad і Sail і сайт ентерокінази з N-кінця CGL:

CGL-exp40X_dir: 5'-AGCTGAGCTCGATGACGATGACAAGATGACAACGTTTCTTATCAAACACAAGGCCAGTG-3',

CGL-exp40_rev: 5'-AGCTGTCGACTTAGGCATAAACTAAAACGCGCTTGTCTTT-3'.

Для створення конструкції pET40CmAP/CGL отриманий ген галактозоспецифического лектину CGL і 2 мкг плазмідної ДНК pET40CmAP обробляють рестриктазами Мікрон і SalI < у відповідності з методикою, описаною вище, і очищають в 1% гелі легкоплавкої агарози. Очищені ПЛР-фрагменти CGL і векторну частина плазміди pET40CmAP зшивають за допомогою лигазной реакції в 50 мкл буфера для лігування згідно інструкції (Fermentas). 10 мкл реакційної суміші використовують для трансформації компетентних клітин E. coli Rosetta(DE3). Трансформантів висівають на LB-агар, що містить 25 мкг/мл канаміцину. Після інкубування протягом 16 год при 37°С клони отсевают, виділяють плазмидную ДНК і аналізують на наявність мутацій за допомогою автоматичного секвенування. Відбирають ДНК, що містить необхідні послідовності генів CmAP і CGL, що представляє собою плазміду pET40CmAP/CGL розміром 8192 п. о. (Фіг.1).

Приклад 2. Отримання рекомбінантного штаму E. coli Rosetta(DE3)/pET40CmAP/CGL - продуцента гібридного бифункционального поліпептиду CmAP/CGL.

Рекомбінантний штам-продуцент E. coli Rosetta(DE3)/pET40CmAP/CGL отримують шляхом тр�ого штаму-продуцента гібридного бифункционального поліпептиду CmAP/CGL вирощують у літровій колбі в рідкому середовищі LB, містить 10 г на літр бакто-триптона, 5 м бакто-дріжджового екстракту і 10 г NaCl, 25 мг/мл канаміцину, рН 7,7, на шейкері при 200 об/хв при температурі 37°С протягом 2 годин до оптичної щільності 0,6-0,8 (OD600), потім додають індуктор експресії IPTG до кінцевої концентрації 0,2 мМ і інкубують при 16°С протягом 12 годин.

Для визначення продуктивності штаму клітинні водні екстракти аналізують електрофорезом у 12,5% поліакриламідному гелі з додецилсульфатом натрію. Гель фарбують Кумасси R-250 за стандартною методикою і визначають відносну кількість білка в смузі цільового продукту. Зміст рекомбінантного білка в розчинній клітинної фракції становить не менше 30% від усіх білків цієї фракції.

Приклад 3. Виділення і характеристика гібридного бифункционального поліпептиду CmAP/CGL.

Рекомбінантний штам-продуцент гібридного бифункционального поліпептиду CmAP/CGL - E. coli Rosetta(DE3)/pET40CmAP/CGL, інкубують в літровій колбі в рідкому середовищі LB, що містить 10 г на літр бакто-триптона, 5 м бакто-дріжджового екстракту і 10 г NaCl, 0,5 мМ IPTG, 25 мг/мл канаміцину, рН 7,7, на шейкері при 200 об/хв протягом 12 годин при 16°С. Бактеріальні клітини осаджують на проточною центрифузі при 5000 об/хв протягом 10 хв. ду. Потім центрифугують при 10000 об/хв протягом 30 хв Надосадову рідину збирають і поміщають на колонці з ДЕАЕ-52-целюлозою (Whatman). Элюцию білка проводять градієнтом концентрації NaCl (0,05 М-0,380 М) в буфері А. Активні фракції збирають і поміщають на колонку з металлоафинной смолою (Qiagen), попередньо врівноважену буфером А. Элюцию білка проводять буфером (50 мМ Tris-HCl, рН 8,6, 50 мМ EDTA, 0,01% NaN3). Активні фракції збирають, обессоливают і концентрують на колонці з ДЕАЕ-Toyopearl 65 ОМ (Toyo Soda), потім інкубують з энтерокиназой (Invitrogen) при кімнатній температурі протягом 12 годин. Потім розчин білка наносять на колонку для гель-фільтрації з Superdex 200 (Sigma). Вихід рекомбінантного білка становить 10 мг з 1 літра культури.

Отриманий рекомбінантний поліпептид визначають за першим 10 амінокислот на автоматичному секвенаторе. Проведене секвенування препарату рекомбінантного білка, виділеного з клітин штаму E. coli Rosetta(DE3)/pET40CmAP/CGL, виявило аминокислотную послідовність Ala-Glu-Ile-Lys-Asn-Val-Ile-Leu-Met-Ile, відповідну першим 10 амінокислот лужної фосфатази CmAP, є N-кінцевий складової химерного білка CmAP/CGL.

Ферментативну функціональність гібридного поліпептиду CmAP/CGL перевіряють за ак�кубационная суміш в обсязі 500 мкл містить 15 мМ п-НФФ, 1 М діетаноламін (ДЕА), рН 10,3 і гібридний білок CmAP/CGL, або 2 мМ п-НФФ, 0,1 М трис-HCl, 0,2 М KCl, рН 9,5-10,0. Після 30 хв інкубації при 37°С реакцію зупиняють додаванням 2 мл 0,5 М NaOH. Кількість утворився в процесі ферментативної реакції п-нітрофенолу (п-НФ) визначають спектрофотометрично при 400 нм. За одиницю активності лужної фосфатази приймають кількість ферменту, що каталізує звільнення 1 мкМ п-НФ (ε400 нм=18600) протягом 1 хв інкубації. Питому активність виражають в одиницях активності ферменту на 1 мг білка. Концентрацію білка в розчині визначають за методом Бредфорда.

Лектинную функціональність гібридного поліпептиду CmAP/CGL перевіряють в реакції гемаглютинації та/або рівнем афінності до муцину: CmAP/CGL розводять дворазово в 100 мкл буферу, який містив 20 мМ Trіs-HCl, рН 8,2. Після цього до розведень приливають по 50 мкл 2% еритроцити людини групи О (I). Протягом години спостерігають гемагглютинацию. Або на сенсибілізований муцином полістирольний мікропланшет вносять розчин (0,0015-0,1 мг/мл) гібридного поліпептиду CmAP/CGL і інкубують 1,5 години при кімнатній температурі. Лектин-пов'язані комплекси відмивають буфером 10 мм трис-HCl, рН 9,0, 0,15 М NaCl, 0,05% Тритон Х-100 200 мкл в кожну лунку не менше 10 �вище, для візуалізації пов'язаних комплексів.

Отримані дані з характеристики та функціональної активності продукту експресії штучного химерного гена гібридного бифункционального поліпептиду CmAP/CGL в клітинах рекомбінантного штаму E. coli Rosetta(DE3)/pET40CmAP/CGL свідчать про відповідність досліджуваного поліпептиду його природному аналогу - галактозоспецифическому лектину CGL, перспективному для використання лектин-імуноферментних та лектин-ферментних методи диференціальної діагностики плацентарної недостатності і онкопатологій трофобласта при вагітності, аденокарциноми товстої кишки людини, гистопатологий нейроцитов симпатичної нервової системи [6-7].

Як випливає з наведених прикладів, що заявляється група винаходів дозволяє отримувати активний рекомбінантний гібридний біфункціональний поліпептид CmAP/CGL з властивостями високоактивної лужної фосфатази морської бактерії CmAP і галактозоспецифичного лектину мідії CGL з високим виходом при відносно простій та надійній технології.

Заявлений винахід дозволяє:

- з допомогою використання рекомбінантного штаму-продуцента E. coli Rosetta(DE3)/pET40CmAP/CGL отримувати шляхом біосинтезу велика кількість актив�ь-фільтраційної хроматографий при очищення рекомбінантного білка з водного екстракту клітин рекомбінантного штаму-продуцента дозволяє отримувати гібридний біфункціональний поліпептид CmAP/CGL з чистотою понад 98% в якості аналога галактозоспецифичного лектину CGL, кон'югованого з ферментом, що застосовується для проведення ІФА і ТЛФА.

Література

1. Tatarinov Yu.S. Trofoblast-specific beta 1-glycoprotein as a marker for pregnancy and malignancies // Gynecol. Obster. Invest. 1978. Vol.9. P. 65-97.

2. Garcia M., Seigner C., Bastid C., Choux R., Payan M. J. and Reggio H. Carcinoembryonic antigen has a different molecular weight in normal colon and cancer due to N-glycosylation differences // Cancer Res. 1991. Vol.51. P. 5679-5686.

3. Fukushima K., Ohkura Т., Kanai M., Kuroki M., Matsuoka Y., Kobata A., Yamashita K. Carbohydrate structures of a normal counterpart of the carcinoembryonic antigen produced by colon epithelial cells of normal adults // Glycobiology. 1995. Vol.5. №1. P. 105-115.

4. Tabares G., Radcliffe C. M., Barrabes S., Ramirez M., Aleixandre R. N, Hoesel W., Dwek R A., Rudd P. M., Peracaula R.,de Llorens R. Different glycan structures in prostate-specific antigen from prostate cancer sera in relation to seminal plasma PSA // Glycobiology. 2006. V. 16. №2. Р. 132-145.

5. Wu J. Т.(1990) Serum alpha-fetoprotein and its lectin reactivity in liver diseases: a review. Ann. Clin. Lab. Sci. 20, 98-105.

6. Чикаловець В. В., Молчанова в. І., Булгаков А. А., Черніков О. В., Петрова В. Ю., Лук'янов В. А. Використання лектинів морських гідробіонтів для діагностики ряду соціально значущих захворювань людини // Вісник ДВО РАН. - 2010. - №5. - С. 1-10.

7. Фуртак Ст. А., Тихонов Я. Н., Чикаловець В. В., Лук'янов В. А. Гистопатология рецепторів лектину CGL в спинномозкових гангліях щурів // Тихоокеан. мед. журн. - 2000. - №4. - С. 41-43.

8. Фуртак Ст. А., Курика А. В., Бєлогорцева Н.І., Чикаловець В. В., Клещенко Ю. О. Клітинна локалізація рецепторів м� кишки людини // Бюл. експ.біології і медицини. - 1999. - Т. 128, №10. - С. 441-444.

9. Kovalchuk S. N., Chikalovets I. V., Chernikov O. V., Molchanova V. I., Li W., Rasskazov V. A., Lukyanov P. A. cDNA cloning and structural characterization of a lectin from the mussel Crenomytilus grayanus with a unique amino acid sequence and antibacterial activity // Fish Shellfish Immunol. - 2013. - V. 35. - №4. - P. 1320-1324.

10. RU 2447151 C1, 10.04.2012.

11. Sambrook J., Fritsch E. F., Maniatis Т. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.

1. Рекомбінантна плазмидная ДНК pET40CmAP/CGL розміром 8192 пар основ (п. о.), що визначає синтез рекомбінантного гібридного бифункционального поліпептиду CmAP/CGL і характеризується наявністю наступних фрагментів: NcoI/SalI < -фрагмент плазміди pET-40b(+) (Novagen) і фрагмента ДНК розміром 2028 п. о., що містить химерний ген, що складається з структурної частини гена лужної фосфатази CmAP, включаючи лінкер (G4S)3EL, і структурної частини гена галактозоспецифического лектину CGL (SEQ ID N 1).

2. Рекомбінантний штам E. coli Rosetta(DE3)/pET40CmAP/CGL, трансформований плазміди pET40CmAP/CGL за п. 1, - продуцент гібридного бифункционального поліпептиду CmAP/CGL.

3. Спосіб отримання рекомбінантного гібридного бифункционального поліпептиду CmAP/CGL, що характеризується тим, що штам-продуцент за п. 2 інкубують в рідкому поживному середовищі LB протягом 12 год при 16°С, потім бактеріальні клітини осаджують центрифугироЌ поміщають на колонку з іонообмінної смолою, далі элюируют білок, потім білковий елюатів поміщають на колонку з металлоаффинной смолою, далі активні фракції концентрують на іонообмінній смолі і виділяють цільовий продукт гель-фільтрацією.



 

Схожі патенти:
Винахід відноситься до галузі біотехнології. Заявлений спосіб отримання пропионилхолинэстерази з тваринної тканини. Гомогенізують ганглії головоногих молюсків дворазовою обробкою ультразвуком. Отриманий гомогенат розводять дистильованою водою, фільтрують суміш центрифугують, надосадову рідину пропускають через хроматографічну колонку, де в якості сорбенту використовують конконавалин A-сефарозу (Con-A-сефароза), і сушать, причому перед сушінням пропионилхолинэстерази в розчин ферменту додають розчин поліетиленгліколю. Розчин ферменту сублімують при температурі досушування не більше 30°C. Перевагою винаходу є отримання пропионилхолинэстерази з оптимальною питомою активністю в промислових масштабах. 1 з.п. ф-ли, 1 пр.

Клітка мицелиального гриба penicillium canescens - продуцент ксиланази і лаккази, спосіб отримання комбінованого ферментного препарату ксиланази і лаккази

Група винаходів відноситься до біотехнології. Запропоновано клітина мицелиального гриба Penicillium canescens зі знятою катаболитной репресією і арабинозной індукцією, яка продукує ксиланазу і лакказу. Трансформована клітина плазміди, що містить промотор гена bgaS, лидерний пептид bgaS, фрагмент ДНК, що кодує ксиланазу, термінатор bgaS, ген β-лактамази і реплікон pMB1, і плазміди, що містить промотор гена bgaS, лидерний пептид bgaS, фрагмент ДНК, що кодує лакказу, термінатор bgaS, ген β-лактамази і реплікон pMB1. Запропоновано також спосіб ферментного препарату ксиланази і лаккази з використанням зазначеної клітини Penicillium canescens. Група винаходів забезпечує підвищення виходу цільових ферментів. 2 н. і 8 з.п. ф-ли, 9 іл., 3 табл., 4 пр.
Винахід відноситься до біотехнології і являє собою спосіб отримання гетерогенного біокаталізаторів на основі гідролази ефірів альфа-амінокислот (AEH) з рекомбінантних бактерій Escherichia coli, що несуть ген aehR з Xanthomonas rubrilineans. Для здійснення способу зазначені рекомбінантні бактерії культивують у відповідних умовах, потім руйнують клітини біомаси методом гомогенізації високого тиску для отримання гомогенату. Після чого проводять іммобілізацію міститься в гомогенате гідролази ефірів альфа-амінокислот шляхом формування ферментних агрегатів під дією осаджувача - сульфату амонію або поліетиленгліколю - з наступною стадією зшивання цих агрегатів глутаровим альдегидом в присутності водорозчинного похідного аминополисахарида хітозану. Отримані гетерогенні біокаталізатори використовують для ферментативного синтезу аминобета-лактамних антибіотиків, наприклад цефалексину, цефпрозила, цефаклора, ампіциліну, амоксициліну, шляхом ацилування ключових бета-лактамних сполук відповідними похідними ефіру D-аминофенилуксусной кислоти. Даний винахід дозволяє отримати гетерогенні біокаталізатори з підвищеною синтетазной активність

Штам бактерій serratia species, є продуцентом позаклітинної рибонуклеази і дезоксирибонуклеази, що володіють противірусною активністю

Винахід відноситься до біотехнології. Штам бактерій Serratia species є продуцентом позаклітинних рибонуклеази і дезоксирибонуклеази, які мають противірусну активність відносно вірусів пташиного грипу A/chickenKurgan/05/2005 (H5N1) і вірусу грипу людини A/Aichi/2/68 (H3N2). Запропонований депонований штам в колекції бактерій, бактеріофагів і грибів Федерального бюджетної установи науки «Державний науковий центр вірусології і біотехнології «Вектор» під реєстраційним номером В-1287. При використанні культуральної рідини або екстракту клітин штаму для виробництва противірусних препаратів нейтралізація вірусів грипу A/chickenKurgan/05/2005 і A/Aichi/2/68 становить 100%. 1 іл., 2 табл., 6 пр.
Винахід відноситься до біотехнології. Спосіб передбачає обробку чутливого шару біосенсора розчином загальної фракції протеаз гепатопанкреаса камчатського краба в буфері складу трис-НСl 50 мМ, СаСl2 3 мМ, 100 мМ NaCl, рН 8,0 при температурі розчину в діапазоні 35-40°С. Процес ведуть в кілька послідовних стадій розчином загальної фракції протеаз гепатопанкреаса камчатського краба в зазначеному розчиннику при температурі 35-40°с З наступною експозицією. Потім чутливий шар біосенсора послідовно промивають додецилсульфатом, розчиненим у тому ж буфері в концентрації 0,1%, а потім водою на кожній стадії. При цьому процес обробки проводять тричі. Винахід дозволяє скоротити тривалість процесу. 1 з.п. ф-ли.

Розріджена біомаса, спосіб її отримання, її застосування і спосіб її зброджування

Винахід відноситься до біотехнології. Запропоновано спосіб отримання розрідженою біомаси, що передбачає отримання матеріалу з біомаси цукрових буряків та/або цукрової тростини, розрідження згаданої біомаси ферментної сумішшю. Зазначену ферментну суміш використовують у кількості щонайменше 0,025% від біомаси. Ферментна суміш включає целлобиогидролазу, бета-глюкозидазу і полигалактуроназу і додатково один або кілька ферментнов з гемицеллюлазной активністю, вибраних з арабинази, ксиланази, пектинметилэстерази, рамногалактуронази і 1,3-/1,6-бета-D-глюканазу. Отриманий в результаті продукт містить залишкового нерозчинного сухої речовини менш як 2 мас.%. Розріджена біомаса є стабільною при зберіганні і може бути використана для отримання продуктів в результаті зброджування, таких як етанол, бутанол, ацетон, 1,3-пропандиол, пропанол, оцтова кислота, молочна кислота пропіонова кислота. 4 н. і 10 з.п. ф-ли, 7 іл., 3 пр.

Спосіб ідентифікації покращених варіантів білка

Винахід відноситься до способу ідентифікації покращених варіантів білка. Спосіб включає тестування безлічі варіантів білка з одиничними замінами у першому тесті першої властивості і в другому тесті другої властивості. Властивості батьківського білка присвоюється значення 1,0 в кожному тесті. Сприятливе перше або друге властивість має значення, що перевищує 1,0, і надмірно несприятливе перше або друге властивість має значення менш ніж приблизно 0,80. Зазначений батьківський білок являє собою протеазу. Першим властивістю є стабільність, другою властивістю є ефективність прання. Здійснюють ідентифікацію заміни, введення заміни в білок для отримання варіанти білка з численними замінами. При цьому заміна не взаємодіє в тривимірній структурі зазначеного батьківського білка, і одна із замін містить зміна сумарного заряду, рівна 0, -1 або -2 по відношенню до батьківського ферменту, і, щонайменше, одна із замін містить зміна сумарного заряду, що дорівнює +1 або +2 по відношенню до батьківського ферменту. Тестують варіант білка з численними замінами в першому і другому тесті і ідентифікують зазначений варіант білка. Винахід пір.

Спосіб обробки матеріалу лігноцеллюлозного

Винахід відноситься до галузі біохімії та біотехнології. Проводять дроблення, просівання лігноцеллюлозного матеріалу та відбір гранул з розміром частинок від 0,08-0,1 мм. В якості лігноцеллюлозного матеріалу використовують солому, траву, тріску, кукурудзяні качани, жом та макуху. Змішують отримані гранули при масовому співвідношенні між гранулами і водою 1:(1-5) при температурі 70-90оС. Диспергируют їх через колоїдну млин протягом 1-2 години для отримання суспензії з розміром частинок 40-80 мкм. Проводять гомогенізацію отриманої суспензії при тиску 50-100 атм і температурі 60-85оС протягом 1-2 годин. Отримують суспензію з частинками розміром 10-40 мкм. Здійснюють буферизацію отриманої суспензії буферним розчином ацетату натрію і оцтової кислоти зі значенням рН=4,8-5,8. Додають суміш ферментів: целюлази в кількості 10-60 міжнародних одиниць на грам лігноцеллюлозного матеріалу, β-глюкозидази в кількості 40-100 міжнародних одиниць на грам лігноцеллюлозного матеріалу і ксиланази в кількості 60-120 міжнародних одиниць на грам лігноцеллюлозного матеріалу. Суміш ферментів вводять в реактор після охолодження суспензії до температури проведення энзимолизиса 40-55оС. Энзимолизис проводять в реакторі протягом 36-72 год�м рідинної хроматографії. Винахід дозволяє провести обробку лігноцеллюлозного матеріалу при невисокій температурі 40-55оС. 6 з.п. ф-ли, 3 іл., 3 пр.
Винахід відноситься до області біохімії і являє собою спосіб виділення ендонуклеази з отрути кобри. Спочатку проводять гель-фільтрацію розчину отрута середньоазіатської кобри (Naja naja oxiana) на сверхмелком сефадексе G-75, потім хроматографію ендонуклеази на SP-сефадексе C-25, діаліз виділеного ферменту з додаванням баластного білка, стерилізацію і лиофилизацию. При цьому перед діалізом додають БСА до кінцевої концентрації 1,0-2,0 мг/мл, а отдиализованную эндонуклеазу без концентрування стерилізують і лиофилизуют. Спосіб дозволяє збільшити вихід ендонуклеази при виділенні, а також усунути перешкоду на шляху її використання для лікування сказу корів. 2 пр.

Спосіб отримання глоботриози

Винахід відноситься до біотехнології. Спосіб отримання глоботриози полягає у ферментативному перенесення галактозного мономеру від донора галактозила на лактозу, що виконує роль акцептора. В якості донора галактозного мономеру використовують β-галактозилазид. В якості ферменту використовують α-1,4-галактозилсинтазу, отриману шляхом введення двох замін D327G і P402D у відповідних положеннях амінокислотної послідовності гену альфа-галактозидази дикого типу, виділеної з Thermotoga maritima. При цьому реакцію проводять при 37°С, рН 5,0 до повного розщеплення β-галактозилазида. Винахід забезпечує підвищення виходу і чистоти глоботриози. 1 з.п. ф-ли, 2 іл., 1 пр.

Модифіковані убиквитиновие білки зі специфічною зв'язує активністю для экстрадомена

Винахід відноситься до галузі біотехнології, конкретно до нових гетеромультимерним білків, отриманих з модифікованого убіквітину, і може бути використане в медицині для лікування або діагностики захворювань, асоційованих з гіперпродукцією экстрадомена В фібронектину (ED-B). Білок включає два мономерних убиквитинових ланки, по-різному модифікованих шляхом заміщень щонайменше 6 амінокислот у положеннях 4, 6, 8, 62, 63, 64, 65 і 66 SEQ ID NO: 1. При цьому в 1-му мономерном ланці заміщення включають: F4W, K6(Н,W, F), Q62N, Е64(K,R або Н), S65(L,F або W), Т66(S або Р), а в 2-му мономерном ланці: K6(Т,N,S або Q), L8(Q,t,N або S), Q62(W, F), K63(S,t,N або Q), Е64(N, S, Т або Q), S65(F або W), Т66(Е або D). Винахід дозволяє отримати модифікований гетеродимерний білок убіквітину, здатний зв'язувати ED-B з високою спорідненістю. 20 н. і 8 з.п. ф-ли, 18 іл., 3 табл., 7 пр.

Спосіб екстракції днк з клітин крові

Винахід відноситься до галузі біотехнології. Запропоновано спосіб екстракції ДНК з клітин крові. Додають зразок магнітні частинки і феромагнітні наносфери CoNiFe2O4 50 нм. Лизируют біологічний матеріал. Промивають ДНК і знімають ДНК з носія. Перевагою заявленого способу є підвищення кількості ДНК в отриманому зразку. 3 іл., 1 пр.

Набір синтетичних олігонуклеотидів для детектування кількості копій гена бета-глюкуронідази в трансгенних рослинах

Винахід відноситься до галузі біохімії, зокрема до набору синтетичних олігонуклеотидів для детектування кількості копій бета-глюкуронідази в трансгенних рослинах, що включає проведення полімеразної ланцюгової реакції з допомогою праймерів і руйнується проби. Винахід дозволяє ефективно детектувати кількість копій бета-глюкуронідази в трансгенних рослинах. 1 іл., 1 табл., 1 пр.

Олігонуклеотидні праймери і спосіб виявлення днк mycobacterium avium методом полімеразної ланцюгової реакції

Винаходи належать до галузі біотехнології і стосуються олігонуклеотидних праймерів і способи виявлення ДНК Mycobacterium avium з їх використанням. Охарактеризовані олігонуклеотидні праймери комплементарни специфічної області mig-гена Mycobacterium avium і мають наступний нуклеотидний склад: 5'-CGT CAA AAG CGA ACT GCA-3' та 5'-ТАА ТТС GTT GCC CGA СТС-3'. Спосіб виявлення ДНК Mycobacterium avium вимикає виділення ДНК, проведення ампліфікації ДНК з використанням олігонуклеотидних праймерів, перенесення продукту ампліфікації на гель з подальшим детектуванням результатів аналізу на трансиллюминаторе. У разі позитивної реакції синтезується фрагмент, відповідний розміру 157 п. н. Представлені винаходи можуть використовуватися у ветеринарних діагностичних і науково-практичних лабораторіях для виявлення генетичного матеріалу Mycobacterium avium у пробах. 2 н. п. ф-ли, 1 іл., 4 пр.

Спосіб ідентифікації гетеромультимерних модифікованих убиквитинових білків зі здатністю зв'язуватися з лігандами

Винахід відноситься до галузі біотехнології і може бути використано для ідентифікації гетеромультимерних убиквитинов зі здатністю зв'язуватися з лігандом-антигеном. Спосіб включає контактування сукупності гетеродимерних модифікованих убиквитинов, включають два мономеру убіквітину, пов'язаних між собою за схемою голова до хвоста, з потенційним лігандом дисплейним способом. При цьому кожен із згаданих мономерів модифікований по-різному і містить 5-8 заміщень в положеннях 2, 4, 6, 8, 62, 63, 64, 65, 66 і 68 SEQ ID NO:1. Далі ідентифікують гетеродимерний модифікований білок, связавшийся з лігандом з спорідненістю зв'язування Kd в діапазоні 10-7-10-12 М і одновалентной зв'язує активністю. Запропоновані ДНК-бібліотеки, що відповідають за отримання популяції згаданих гетеромультимерних убиквитинов, а також бібліотеки білків, отримані шляхом експресії згаданих ДНК-бібліотек. Винахід дозволяє отримати нові зв'язуючі білки на основі гетеромультимерного убіквітину, здатні специфічно зв'язуватися з високою спорідненістю з вибраними лігандами. 3 н. і 5 з.п. ф-ли, 17 іл., 4 пр.

Спосіб виділення микрорнк з біологічних рідин

Винахід відноситься до біотехнології, зокрема до способу виділення микроРНК з біологічних рідин, що містять экзосоми. Спосіб включає послідовне центрифугування, ультрафільтрацію і ультрацентрифугування культуральної конденсованої середовища. Розчиняють отриманий осад у фосфатно-сольовому буфері і повторно центрифугують. Розчиняють отриманий осад у воді. Піддають отриманий розчин електрофорез у вільному потоці на приладі FFE System. Проводять ультрацентрифугування кожної з отриманих фракцій. Очищають кожну фракцію від клітинних стінок экзосом допомогою фільтрування та центрифугування. Проводять реакцію зворотної транскрипції за допомогою зворотної транскриптази. Зупиняють реакцію нагріванням до 95°С протягом 5 хвилин. Запропоноване винахід дозволяє виділити микроРНК з біологічних рідин, що містять экзосоми, з високим виходом. 2 іл., 1 пр.

Багатоканальний наконечник для екстракції нуклеїнових кислот, білків і пептидів

Група винаходів відноситься до багатоканальним пристроїв, модифікованим нанослоями анилинсодержащих полімерів. Запропоновано багатоканальний наконечник для виділення нуклеїнових кислот, білків, пептидів і спосіб виготовлення багатоканального елемента, що входить до складу багатоканального наконечника. Наконечник складається з скляного гексагонального багатоканального масиву, який містить багатоканальні елементи з безлічі паралельних капілярів. На внутрішній поверхні капілярів завдано сорбційний шар, який складається з від одного до трьох полімерних наношарів. Багатоканальний елемент виконаний з захисним обрамленням з кількох рядів скляних стрижнів. Скляний гексагональний багатоканальний масив складається з покладених багаторазово витягнутих одиничних багатоканальних елементів з капілярів діаметром від 1 мкм і більше, робочою поверхнею до 500 см2, об'ємом до 500 мкл. Спосіб виготовлення багатоканального елемента включає збирання скляних трубок у багатоканальний пакет, закріплення одного його кінця в захопленні вузла подачі, нагрівання в печі іншого кінця з утворенням цибулини і витяжку до необхідного розміру. У процесі формування для отримання структур з диамено сформованих укладанням елементів шестигранної форми. Винаходи забезпечують проведення експрес-виділення та очищення як нуклеїнових кислот, так і білків, пептидів, а також забезпечують високу відтворюваність результатів. 2 н. і 3 з.п. ф-ли, 6 іл., 3 табл., 9 пр.

Пристрій автоматичного очищення нуклеїнової кислоти і спосіб для захисту від аерозолю

Група винаходів відноситься до галузі біотехнології, зокрема до автоматичного пристрою і способу очищення та виділення цільової нуклеїнової кислоти з біологічного зразка, причому пристрій забезпечує можливість запобігти забрудненню виділеної цільової нуклеїнової кислоти від аерозолю і яке може бути застосоване до всіх видів обладнання виділення та очищення нуклеїнових кислот з безлічі біологічних зразків, що використовує магнітний стержень або мультипипеточний блок, що рухається в двох або трьох осьових напрямках. Група винаходів забезпечує підвищення якості очищення виділених з біологічного зразка цільових нуклеїнових кислот від забруднення їх аерозолем, який утворюється з біологічного зразка, що містить цільову нуклеїнову кислоту у високій концентрації, для забезпечення більш точних результатів подальших досліджень виділених цільових нуклеїнових кислот. 2 н. і 17 з.п. ф-ли, 19 іл.

Незалежний від сигнальної послідовності фаговий дисплей на білку pix

Винахід відноситься до галузі молекулярної біології, біохімії та генетичної інженерії. Запропоновано геном фага, фагмида і нитчатий фаг для використання в фаговом дисплеї, система фагового дисплею, набір і phage бібліотека для визначення продукту екзогенного гена. Винахід може бути використаний у дослідженнях білків і при розробці діагностичних і терапевтичних засобів на основі білків. 6 н. і 5 з.п. ф-ли, 5 іл., 1 пр.

Рекомбінантна плазмидная днк pet40cmap/mbl-t, кодує гібридний біфункціональний поліпептид cmap/mbl-t з властивостями високоактивної лужної фосфатази cmap і манан-зв'язуючого лектину з-типу mbl-t, рекомбінантний штам e. coli rosetta(de3)/pet40cmap/mbl-t - продуцент гібридного бифункционального поліпептиду cmap/mbl-t і спосіб його одержання

Винахід відноситься до біотехнології і являє собою плазміду pET40CmAP/MBL-T, визначальну синтез гібридного бифункционального поліпептиду CmAP/MBL-T з властивостями високоактивної лужної фосфатази морської бактерії Cobetia marina (CmAP) і манан-зв'язуючого лектину З-типу далекосхідного трепанга Apostichopus japonicus (MBL-T). Плазміда містить NcoI/SalI < - фрагмент плазміди рЕТ-40b(+) (Novagen) і фрагмент ДНК розміром 2034 пар основ, що є химерним геном, кодирующим структурні гени лужної фосфатази CmAP і манан-зв'язуючого лектину З-типу MBL-T, сполучених між собою полинуклеотидом, кодирующим аминокислотную послідовність лінкера (G)4S(G)4S(G)4SEL. Описаний рекомбінантний штам E. coli Rosetta(DE3)/pET40CmAP/MBL-T, трансформований зазначеної плазміди, - продуцент гібридного бифункционального білка CmAP/MBL-T. Запропоновано також спосіб отримання гібридного бифункционального білка CmAP/MBL-T c використанням заявленого штаму. Винахід дозволяє отримувати високоочищений препарат гібридного білка CmAP/MBL-T з властивостями рекомбінантної високоактивної лужної фосфатази CmAP і високоспецифичного манан-зв'язуючого лектину З-типу MBL-T по відношенню до вуглеводною компонентів глікопротеїнів ракових клітин шийки матки і можетностики раку шийки матки.3 н. п. ф-ли, 2 іл., 3 пр.

Штам escherichia coli bl21(de3)gold/petmin-cypa - продуцент рекомбінантного циклофіліном а людини

Винахід відноситься до галузі біотехнології і стосується штаму Escherichia coli BL21(DE3)Gold/pETmin-CypA - продуцента рекомбінантного циклофіліном А людину. Охарактеризований штам отриманий шляхом трансформації клітин штаму BL21(DE3)Gold плазміди pETmin-CypA. Плазміда має розмір 5865 пар нуклеотидів і містить фрагмент XhoI-NdeI вектора рЕТ-22b(+), що несе ген стійкості до ампіциліну ampR, промотор та термінатор РНК-полімерази фага Т7 і полилинкер. По сайтам XhoI-NdeI клонований фрагмент, отриманий за допомогою ПЛР з використанням олігонуклеотидних праймерів 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC і 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC плазміди pCyPAwt/pGEX-2TK з клонованим фрагментом гена рчЦфА розміром 498 п. н. Запропонований штам високопродуктивен, не вимагає складної системи очищення і може бути використаний в протипухлинної терапії. 2 іл.
Up!