Дріжджі, що мають підвищений вміст серосодержащего з'єднання, спосіб відбору таких дріжджів і спосіб їх культивування

 

Даний винахід відноситься до дріжджів, що містить серосодержащие з'єднання, способу відбору дріжджів і способу культивування дріжджів. Дріжджі, що містять високий відсоток серосодержащего з'єднання, у відповідності з цим винаходом застосовні в області продуктів харчування, лікарських засобів, хімічних продуктів, кормів і т. п.

Досі сірковмісні сполуки широко використовуються в області продуктів харчування, лікарських засобів, хімічних продуктів і т. п. Наприклад, відомо, що глутатіон (GSH), який є трипептидом, що складається з глутамату, цистеїну і гліцину, має фармацевтичний ефект. В даний час препарат GSH класифікують як антидот або офтальмический агент і використовують для різних видів залежностей, хронічного захворювання печінки, попередження порушень, обумовлених побічними ефектами протиракових агентів і радіотерапії, дерматозу і терапії катаракти або пошкодження рогівки (Protein, Nucleic Acid and Enzyme 1988-7 Vol. 33 No. 9 ISSN003909450, додатковий випуск "Epoch for research of glutathione" p. 1626).

З іншого боку глутатіон відомий в якості речовини, яка надає продуктам харчування багатство смаку (Y. Ueda et al., Biosci. Biotech. Biochem., 61, 1977-1980 (1977)), а дрожжся, що γ-глутамилцистеин, який є дипептидом, що складається з глутамату і цистеїну, застосуємо для продукту харчування.

Як описано вище, сірковмісні сполуки мають широке промислове застосування, і з цієї причини проводилися різні дослідження, що стосуються отримання мікроорганізму, який ефективно продукує ці сполуки. Наприклад, є повідомлення, в яких описується спосіб, що включає оцінку ферменти-мішені в шляху біосинтезу серосодержащего з'єднання і підвищення вмісту серосодержащего з'єднання в клітинах шляхом модифікації функції цього ферменту-мішені. Наприклад, повідомляється, що вміст глутатіону в клітинах підвищується при введенні в дріжджі гена γ-глутамилцистеинсинтетазиE. coli(Yasuyuki OHTAKE et al., Agric. Товарbiol. Chem., 52(11), 2753-2762, 1988) або гена глутатионсинтетазиE. coli(Yasuyuki OHTAKE et al., Journal of FERMENTATION AND BIOENGINEERING, Vol. 68, No. 6, 390-394, 1989).

Також повідомляється спосіб підвищення вмісту глутатіону шляхом введення ферменту, залученого в синтез глутатіону в дріжджах (JP 61-52299 А, JP 62-275685 А, JP 63-129985 А і JP 04-179484 А).

Також повідомлялися способи відбору мікроорганізму, що має підвищений кліткове утримання серосодержащего сполуки, що включають мутирование мікроорганізму і рпособного рости на живильному середовищі (стійкого до лікарського засобу штами), або штаму, нездатного рости на живильному середовищі (чутливого до лікарського засобу штами), за допомогою методу реплік. Наприклад, повідомляється спосіб, що включає мутирование дріжджів, що належать роду Candida, і відбір штаму, здатного рости в живильному середовищі, що містить этионин і судьфит, (JP 59-151894 А, JP 03-18872 А і JP 10-191963 А) і спосіб, що включає мутирование дріжджів, що належать роду Saccharomyces, і відбір штаму, що має збільшену стійкість до цинку (JP 02-295480 А). Крім цих способів були досліджені різні агенти для того, щоб підвищити клітинну вміст сірковмісних сполук (JP 06-70752 А і JP 08-70884 А).

Крім того, нещодавно повідомлялося про отримання за допомогою випадкової мутації штамівSaccharomyces cerevisiae, що містять 5 мас.% або більше глутатіону в клітинах (JP 2004-180509 А). У цьому документі вміст глутатіону в одному за іншим мутантом визначали для отримання штамів, що продукують глутатіон у високому відсотку. Хоча в документі говорилося, що спосіб робить можливою швидку оцінку великої кількості штамів, при вивченні описаного в документі способу автором цього винаходу було виявлено, що кількість штамів, що одна людина може оцінити за день, становить саме більшіс�жними і є дорогими і вимагають багато часу.

До речі, відомо, що у дріжджів, що демонструють ауксотрофию за аденину, зокрема у дріжджів, що мають мутацію в гені ADE1 або гені ADE2, проявляється червоний колір. В останні роки механізм червоного фарбування був проаналізований на генетичному рівні. Тобто виявлено, що AIR або CAIR в якості проміжних продуктів при біосинтезі аденіну, які акумулюються при мутації гена ADE2, що кодує фермент, що каталізує шосту сходинку біосинтезу пуринів і проміжного продукту AIR, або при мутації гена ADE1, що кодує фермент, що каталізує сьому сходинку біосинтезу пуринів і проміжного продукту CAIR, зв'язуються з глутатионом і переносяться у вакуолю, в результаті чого виявляється червоний колір (K. G. Sharma et al., Arch Microbiol. (2003) 180: 108-117). Проте у цьому документі повідомляється, що при надекспресії гена GSH1, що кодує обмежує швидкість при біосинтезі GSH фермент, зміни інтенсивності червоного кольору не було. Отже, у фахівця з середнім рівнем компетентності в даній області техніки не могло виникнути ідеї використання ауксотрофии за аденину для відбору дріжджів, що містять високий відсоток GSH.

Завдання цього винаходу полягає в наданні дріжджів, имесоба культивування дріжджів з наданням дріжджам можливості акумулювати в клітинах серосодержащие з'єднання у високому відсотку.

Автори цього винаходу докладно вивчили повідомлення Sharma та ін. (Arch. Microbiol (2003) 180: 108-117) і висунули гіпотезу, що оскільки біосинтез аденіну залучений в біосинтез АТФ, який є істотним для організмів, в ауксотрофних за аденину штами, таких як штами із зруйнованим геном ADE2 або геном ADE1, в клітинах достатньою мірою акумулюється такий проміжний продукт, як AIR або CAIR. Автори цього винаходу вважали, що, якщо гіпотеза вірна, прояв червоного кольору у дріжджів контролює клітинну вміст глутатіону, і дріжджі, у яких проявляється червоний колір більшої інтенсивності, могли б мати більш високий вміст глутатіону. В результаті великих вивчень, на відміну від повідомлення Sharma та ін., автори цього винаходу виявили, що дріжджі, що містять високий відсоток глутатіону, можна відібрати, використовуючи в якості показника червоний колір, і виявили, що клітинне зміст серосодержащего з'єднання, в тому числі глутатіону, можна підвищити поєднанням чутливості до селенової кислоті зі здатністю до прояву червоного кольору, обумовленої доданням ауксотрофии за аденину і культивуванням на мінімальній живильному середовищі, доповненої м�доставляння дріжджів, мають підвищену кліткове утримання серосодержащего з'єднання, причому зазначені дріжджі демонструють чутливість до селенової кислоті і розвивають червоний колір при їх культивуванні на живильному середовищі.

Іншим аспектом цього винаходу є надання описаних вище дріжджів, причому зазначена живильне середовище містить метіонін.

Іншим аспектом цього винаходу є надання описаних вище дріжджів, розвиваючих червоний колір при доданні ауксотрофии за аденину.

Іншим аспектом цього винаходу є надання описаних вище дріжджів, в яких зазначена ауксотрофия за аденину додана модифікацією гена ADE1 або гена ADE2.

Іншим аспектом цього винаходу є надання описаних вище дріжджів, які, додатково, мають мутацію в гені ADE4 або гені ADE8, і при цьому, розвивають білий колір при їх культивуванні на живильному середовищі.

Іншим аспектом цього винаходу є надання описаних вище дріжджів, в яких зазначена чутливість до селенової кислоті додана модифікацією для збільшення експресії гена МЕТ25.

Іншим аспектом цього винаходу є п�ре одне з'єднання, обраний із групи, що складається з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина.

Іншим аспектом цього винаходу є надання способу культивування описаних вище дріжджів, що включає культивування зазначених дріжджів умови надлишку аденіну для збільшення дріжджових клітин і потім культивування зазначених дріжджів умови недостатнього змісту аденіну для підвищення клітинного змісту серосодержащего з'єднання.

Іншим аспектом цього винаходу є надання способу відбору дріжджів, мають підвищений кліткове утримання серосодержащего з'єднання, що включає піддає дріжджів, які демонструють ауксотрофию за аденину і чутливість до селенової кислоті, обробці для модифікації гена, розподіл модифікованих дріжджів у живильному середовищі, на якій дріжджі можуть ставати червоними в разі нестачі аденіну, для утворення колоній дріжджів і відбір колонії дріжджів, яка червоніший, ніж до модифікації.

Іншим аспектом цього винаходу є надання способу відбору дріжджів, мають підвищений кліткове утримання серосодержащего з'єднання, що включає� гена, розподіл модифікованих дріжджів за мінімальною живильному середовищі, доповненої метіоніном, для утворення колоній дріжджів і відбір колонії дріжджів, яка червоніший, ніж до модифікації.

Іншим аспектом цього винаходу є надання описаного вище способу, в якому зазначеним сірковмісних з'єднанням є щонайменше одне з'єднання, обраний із групи, що складається з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина.

КОРОТКИЙ ОПИС КРЕСЛЕНЬ

На фіг. 1 демонструється зміна з плином часу вмісту GSH в штамі Y-3256.

На фіг. 2 демонструється схема конструювання касети для руйнування гена GSH2.

ОПИС ПЕРЕВАЖНИХ ВАРІАНТІВ ЗДІЙСНЕННЯ

Використовувані в цьому винаході дріжджі особливо не обмежені за умови, що дріжджі демонструють чутливість до селенової кислоті і розвивають червоний колір при їх культивуванні на живильному середовищі, і вони, в силу цього, мають підвищений кліткове утримання серосодержащего з'єднання. Приклади їх включають дріжджі, що належать роду Saccharomyces, наприклад,Saccharomyces cerevisiaeдріжджі, що належать роду Candida, наприклад,Candida utilis, дріжджі, прин/i>. Серед них домінуючими єSaccharomyces cerevisiaeіCandida utilis, які часто використовуються при продукції серосодержащего з'єднання. Дріжджі цього винаходу можуть бути гаплоидом або можуть бути з подвійним або більше набором хромосом.

Використовувана для оцінки прояви червоного кольору живильне середовище особливо не обмежена за умови, що живильним середовищем є середовище, на якій у дріжджів може проявлятися червоний колір при виснаженні аденіну в дріжджових клітинах. В якості прикладу наводиться живильне середовище, що має зміст аденіну, що становить 25 мг/л або менше, та її конкретні приклади включають живильне середовище YPD (1% бактодрожжевого екстракту, 2% бактопептона і 2% глюкози; METHODS IN YEAST GENETICS 2000 Edition p.171: ISBN 0-87969-588-9) і живильне середовище PGC (0,5% казаминовой кислоти (без вітамінів), 1% бактопептона і 2% глюкози). Кращою є живильне середовище PGC, на якій у дріжджів може легко проявлятися червоний колір більшої інтенсивності під впливом дуже малої кількості з'єднання. У дріжджів проявляється більш ясно червоний колір при додаванні в живильне середовище кадмію, і, отже, переважно додавати кадмій. Переважно середовище доповнюють метион� що штам утворює колонію червоного кольору, і червоне фарбування можна оцінити на основі кольору колонії. Спосіб надання червоного кольору можливості проявитися особливо не обмежений, і його конкретні приклади включають надання ауксотрофии за аденину і культивування на мінімальній живильному середовищі, доповненої метіоніном.

У цьому винаході вираз «демонструє ауксотрофию за аденину» означає, що штам не може утворювати колонії на твердому живильному середовищі, що не містить аденін, або утворює колонії невеликого розміру, як це робить штам Y-3219, на живильному середовищі. Ген, відповідальний за ауксотрофию за аденину, може бути визначено або може бути не визначений, але переважно, коли ген, відповідальний за ауксотрофию за аденину, визначено. Ген, відповідальний за ауксотрофию за аденину можна визначити шляхом аналізу отриманого ауксотрофного за аденину штаму за допомогою аналізу комплементации або аналізу послідовності. Переважно, коли дріжджі цього винаходу демонструють ауксотрофию за аденину внаслідок модифікації для інактивації щонайменше одного гена, залученого в біосинтез аденіну, такого як ген ADE2 і ген ADE1, які безпосередньо впливають на аккуму�ія для інактивації гена включає введення мутації, яка ліквідує активність продукту гена щодо гена і модифікацію, яка ліквідує експресію гена.

У цьому винаході вираз «піддає обробці для модифікації гена» означає, що мутують нуклеотидну послідовність батьківського штаму. Можна використовувати звичайну технологію мутирования, і можна також використовувати технологію рекомбінації генів. Приклади звичайних технологій мутирования включають метод мутирования гена опроміненням УФ-світлом або лазером і метод з використанням агента для мутагенезу, такого як EMS, MNNG або DAPA (натрію 4-диметиламинобензолдиазосульфоната). Крім того, може також бути включена зустрічається в природі мутація, яка має місце при культивуванні мікроорганізму. Ауксотрофние за аденину штами можна отримати мутованим дріжджів і відбором штаму, який може рости містить аденін живильному середовищі, але не може зростати або погано росте в живильному середовищі, що не містить аденін. Більш того, у штаму, має мутацію в гені ADE1 або гені ADE2, демонструється ауксотрофия за аденину і проявляється червоний колір при його культивуванні на живильному середовищі.

Модифікація з використанням технології рекомбінації газрушенного типу) з допомогою гомологічної рекомбінації.

Вищезгадану заміну гена можна здійснити наступним чином. Тобто дріжджі трансформують рекомбінантної ДНК, що містить мутантний ген ADE1, для виклику рекомбінації між мутантним геном ADE1 і хромосомних геном ADE1. З цієї причини маркерний ген, вбудований в рекомбинантную ДНК залежно від таких властивостей, як аусотрофия господаря, полегшує маніпулювання. Більш того, лінеаризація вищезгаданої рекомбінантної ДНК наприклад, з допомогою розщеплення ферментом рестрикції і, крім того, видалення контролює реплікацію області, яка функціонує у дріжджів, з рекомбінантної ДНК може привести до ефективного одержання штаму, в якому рекомбінантна ДНК вбудовується в хромосому.

Для трансформації дріжджів можна використовувати такі методи, які зазвичай використовуються при трансформації дріжджів, такі як метод протопластів, метод KU, метод KUR, метод електропорації і т. п. Штам, в якому рекомбінантна ДНК інтегрується в хромосому вищезазначеним чином, зазнає рекомбінацію між мутантним геном ADE1 і геном ADE1, вроджено існуючим на хромосомі, так що два злитих гена, тобто ген ADE1 дикого типу і мутантний ген ADE1, стають вбудованими в хромосому так, щоб між дтем для того, щоб на хромосомної ДНК залишився тільки мутантний ген ADE1, одна копія гена ADE1 разом з сегментом вектора (включає також маркерний ген) видаляється з хромосомною ДНК з допомогою рекомбінації двох генів ADE1. З цієї причини існують два випадки. В одному випадку ген ADE1 дикого типу залишається на хромосомної ДНК, а мутантний ген ADE1 виключається з неї. В іншому випадку, навпаки, мутантний ген ADE1 залишається на хромосомної ДНК, а дикий ген ADE1 виключається. В обох випадках маркерний ген виключається, так що випадок другий рекомбінації можна підтвердити за фенотипом, відповідного маркерного гена. Що є метою штам з заміною гена можна відібрати за допомогою ампліфікації гена ADE1 способом ПЛР та перевірки його структури.

Хоча заміна гена пояснена з посиланням на ген ADE1, таким же чином можна піддати модифікації інші гени, в тому числі ген ADE2.

Переважно, коли ген ADE4 або ген ADE8 також мутації у дріжджів цього винаходу, оскільки дріжджі, що мають мутацію в гені ADE4 або ADE8, демонструють нормальний білий, а не червоний колір. Штам, який має мутацію в гені ADE4 або ADE8, крім мутації в гені ADE1 або гені ADE2, можна отримати спочатку введенням мутації в ген ADE1 або ген ADE2 з відбором штаму, їм показника і потім введенням мутації в ген ADE4 або ADE8, за допомогою чого можна ефективно отримати білі дріжджі, що містять високий відсоток серосодержащего з'єднання.

Введення мутації в ген ADE4 або ADE8 можна здійснити таким же способом, як і використовуваний для гена ADE1 і гена ADE2 спосіб, описаний вище.

Ген ADE1, ген ADE2, ген ADE4 і ген ADE8 можуть бути генами виду дріжджів, однакового з видом дріжджів, що піддаються модифікації. Наприклад, можна використовувати ген ADE1, ген ADE2, ген ADE4 і ген ADE8Saccharomyces cerevisiae, мають нуклеотидні послідовності SEQ ID NO: 1, 3, 5 і 15 відповідно. Ген ADE1, ген ADE2, ген ADE4 і ген ADE8 не обмежені цими генами за умови, що вони мають гомологію послідовностей, достатню для виклику гомологічною рекомбінації з ген на хромосомі модифікуються дріжджів. Отже, ген ADE1, ген ADE2, ген ADE4 і ген ADE8 можуть бути ДНК, кодирующими амінокислотні послідовності, ідентичні на не менше 80%, переважно на не менше 90%, більш переважно на не менш 95%, набагато більш переважно на не менш 98% SEQ ID NO: 2, 4, 6 і 16 відповідно. Ген ADE1, ген ADE2, ген ADE4 і ген ADE8 можуть бути ДНК, які гибридизуются з нуклеотидними послідовностями SEQ ID NO: 1, 3, 5 і 15, відповідно, в жорстких умовах. Прикладами жорстких умов є�відповідної 0,1 × SSC, 0,1% SDS при 60°С.

У цьому винаході вираз «мають чутливість до селенової кислоти» означає, що дріжджі не можуть утворювати колонії на поживному середовищі, що містить селеновую кислоту і метіонін (наприклад, живильному середовищі, що містить 5 мМ селеновую кислоту і 1 мМ метіонін). Селеновая кислота є структурним аналогом сірчаної кислоти і токсичною для живого організму. Як правило, система поглинання сірчаної кислоти супрессирована сероорганическими сполуками, такими як метіонін, в дріжджових клітинах, так що селеновая кислота не надходить у клітини, і дріжджі можуть рости в присутності селенової кислоти. З іншого боку в чутливому до селенової кислоті штамі система поглинання сірчаної кислоти не супрессирована сероорганическими сполуками, і селеновая кислота надходить в клітини. Оскільки система поглинання сірчаної кислоти не супрессирована, продукція сірковмісних сполук збільшена в чутливому до селенової кислоті штамі порівняно зі штамом дикого типу (MOLECULAR AND CELLULAR BIOLOGY Dec, 1995, p. 6526-6534).

Чутливість до селенової кислоті можна надати мутаційної обробкою або з допомогою рекомбінації генів. Наприклад, чутливий до селенової ке, містить селеновую кислоту і метіонін.

З іншого боку чутливість до селенової кислоті можна надати за допомогою рекомбінації генів, наприклад, рекомбінації генів для збільшення експресії гена МЕТ25, який кодує Про-ацетилгомосеринсульфгидрилазу, порівняно зі штамом дикого типу. Експресію гена МЕТ25 можна збільшити шляхом збільшення числа копій гена МЕТ25 з допомогою введення плазміди, що несе ген МЕТ25, або введення гена МЕТ25 в хромосому дріжджів або заміни промотора гена МЕТ25 більш сильним промотором.

Експресію гена МЕТ25 також можна збільшити шляхом модифікації білка, який регулює транскрипцію гена МЕТ25. Механізмом експресії гена МЕТ25 вважається наступний механізм. Тобто продукт гена МЕТ4 функціонує в якості позитивного регулятора експресії гена МЕТ25. Зазвичай продукт гена МЕТ4 утворює комплекс SCFMET30 разом з продуктом гена МЕТ30 та кількома іншими білками, і продукт гена МЕТ4 піддається убиквитинилированию і розкладання разом з продуктом гена МЕТ30 з допомогою протеолітичної системи протеасом 26S, за допомогою чого експресія гена МЕТ25 супрессируется. З іншого боку, при погіршенні функції комплексу SCFMET30 продукт гена МЕТ4 і продукт генаal 19: 282-294, 2004). Отже, експресію гена МЕТ25 можна збільшити введенням мутації в ген МЕТ4 або ген МЕТ30.

Як мутантного гена МЕТ4, який може збільшити експресію гена МЕТ25, повідомляється про гені, що кодує МЕТ4, в якому серин в положенні 215 замінений пролін, і гені, що кодує МЕТ, в якому ізолейцин в положенні 156 заміні серином (Ohmura et al., FEBS Letters 387(1996) 179-183; JP 10-33161А).

Як мутантного гена МЕТ30, який може збільшити експресію гена МЕТ25, повідомляється про гени, що кодують МЕТ30, в якому мутовані залишки амінокислот у повторі WD40. Крім того, в JP 2004-201677А повідомляється про мутантном гені МЕТ30, кодирующим МЕТ30, в якому серин в положенні 569 замінений іншими амінокислотами, такими як фенілаланін.

З допомогою заміни гена дикого типу на хромосомі генами мутантного типу можна збільшити експресію гена МЕТ25, за допомогою чого можна надати чутливість до селенової кислоті.

Ген МЕТ25, ген МЕТ30 і ген МЕТ4 можуть бути генами виду дріжджів, однакового з видом дріжджів, що піддаються модифікації. Наприклад, можна використовувати ген МЕТ25, ген МЕТ30 і ген МЕТ4Saccharomyces cerevisiae, мають нуклеотидні послідовності SEQ ID NO: 9, 11 і 7, відповідно. Ген МЕТ25, ген МЕТ30 і ген МЕТ4 не обмежені�, а ген МЕТ30 і ген МЕТ4 кодують білок, що має функцію репрессора експресії гена МЕТ25. Отже, ген МЕТ25, ген МЕТ30 і ген МЕТ4 можуть бути ДНК, кодирующими амінокислотні послідовності, ідентичні на не менше 80%, переважно на не менше 90%, більш переважно на не менш 95%, набагато більш переважно на не менш 98% SEQ ID NO: 10, 12 та 8, відповідно. Ген МЕТ25, ген МЕТ30 і ген МЕТ4 можуть бути ДНК, які гибридизуются з нуклеотидними послідовностями SEQ ID NO: 9, 11 і 7, відповідно, в жорстких умовах. Приклади жорстких умов описані вище.

Завдяки поєднанню ауксотрофии за аденину з чутливістю до селенової кислоті кліткове утримання серосодержащего з'єднання в дріжджах цього винаходу вище, ніж в аналогічному штамі відповідних дріжджів, який не демонструє ауксотрофию за аденину і демонструє чутливість до селенової кислоті.

У цьому винаході серосодержащие з'єднання відноситься до речовини, що має групу-SH в хімічній формулі, і може бути білком, пептидом, амінокислотою або іншою речовиною. Металлотионеин, у якому 30% складових амінокислот складаються із залишків цистеинов, є прикладом білка, глутатіон, γ-глута�еин є прикладом іншої речовини, але серосодержащие з'єднання не обмежена ними. Як сірковмісних сполук переважними є глутатіон, γ-глутамилцистеин і цистеїн, оскільки вони широко застосовуються в промисловості.

При акумуляції глутатіону в якості серосодержащего з'єднання в клітинах дріжджів переважно, коли дріжджі додатково модифіковані для збільшення внутрішньоклітинної активності глутатионсинтетази та/або γ-глутамилцистеинсинтетази. Активності цих ферментів можна збільшити шляхом збільшення числа копій гена(ів), що кодують ці ферменти, або заміни промотора гена(ів) більш сильним геном. В JP 2005-073628 представлені нуклеотидна послідовність гена γ-глутамилцистеинсинтетази, що відбувається зSaccharomyces cerevisiaeі нуклеотидні послідовності гену глутатионсинтетази і гена γ-глутамилцистеинсинтетази, що відбуваються зCandida utilis. Нуклеотидна послідовність гена глутатионсинтетази, що відбувається зSaccharomyces cerevisiaeі кодується нею амінокислотна послідовність показані в SEQ ID NO: 13 і 14 відповідно.

При акумуляції γ-глутамилцистеина як серосодержащего з'єднання в клітинах дріжджів переважно, коли дріжджі додатково модифжжи додатково модифіковані для зниження внутрішньоклітинної активності глутатионсинтетази і для збільшення внутрішньоклітинної активності γ-глутамилцистеинсинтетази. Активність глутатионсинтетази можна зменшити руйнуванням гена глутатиосинтетази або введенням мутації в ген глутатионсинтетази, так щоб зменшувалася активність глутатионсинтетази.

Мутацією для зменшення активності глутатионсинтетази є, наприклад, мутація, яка призводить до заміни аргініну в положенні 370 амінокислотної послідовності SEQ ID NO: 14 кодоном термінації.

Інші приклади мутацій для зменшення активності глутатионсинтетази включають такі мутації (WO 03/046155):

(1) мутацію, яка призводить до заміни треоніна в положенні 47 в амінокислотної послідовності SEQ ID NO: 14 ізолейцином;

(2) мутацію, яка призводить до заміни гліцину в положенні 387 в амінокислотної послідовності SEQ ID NO: 14 аспарагінової кислотою;

(3) мутацію, яка призводить до заміни проліну в положенні 54 в амінокислотної послідовності SEQ ID NO: 14 лейцином.

Мутація може бути одиничною мутацією (1) або (2) або будь-якою комбінацією з (1)-(3) і переважно комбінацією (1) з (3) або комбінацією (2) з (3).

Оскільки при розкладанні γ-глутамилцистеина утворюється цистеїн, дріжджі, мають підвищений кліткове утримання цистеїну можна отримати тепловою обробкою дріжджів, що мають �суспільстві серосодержащего з'єднання в клітинах дріжджів переважно, щоб дріжджі були додатково модифіковані для збільшення внутрішньоклітинної активності ЕСМ38 (Yeast. 2003 Jul. 30; 20(10): 857-63).

Вищезазначені дріжджі, які демонструють ауксотрофию за аденину і чутливість до селенової кислоті, можна створити так, щоб вони містили більше серосодержащего з'єднання, шляхом подвергания їх процедурі модифікації гена, переважно мутаційної обробці, потім розподілу модифікованих дріжджів у живильному середовищі, на якій дріжджі можуть ставати червоними в разі нестачі аденіну, для утворення колоній дріжджів і відбору дріжджовий колонії, яка червоніший, ніж до модифікації.

У цьому винаході використовується для відбору живильне середовище особливо не обмежена за умови, що живильне середовище є середовищем, в якій у дріжджів може проявлятися червоний колір при виснаженні аденіну в дріжджових клітинах. В якості прикладу наводиться живильне середовище, що має зміст аденіну, що становить 25 мг/л або менше, і конкретні приклади її включають живильне середовище YPD (1% бактодрожжевого екстракту, 2% бактопептона і 2% глюкози; METHODS IN YEAST GENETICS 2000 Edition p.171: ISBN 0-87969-588-9) і живильне середовище PGC (0,5% казаминовой кислоти (без вітамінів), 1% бак�ляться червоний колір більшої інтенсивності під впливом дуже малої кількості з'єднання. У дріжджів проявляється більш ясно червоний колір при додаванні в живильне середовище кадмію, і, отже, переважно додавати кадмій. Переважно використовують агаризованому тверду живильне середовище, а не рідку живильне середовище, так що штам легко виділити для використання в подальших стадіях. З метою ясного спостереження за інтенсивністю прояву кольору кращим є культивування дріжджів на живильному середовищі при 20-30οС протягом приблизно одного тижня.

Дріжджі, що мають підвищений кліткове утримання серосодержащего з'єднання, можна також отримати шляхом подвергания дріжджів, які демонструють чутливість до селенової кислоті, процесу модифікації гена, переважно мутаційної обробці, розподілу модифікованих дріжджів за мінімальною живильному середовищі, доповненої метіоніном, для утворення колоній дріжджів і відбору колонії дріжджів, яка червоніший, ніж до модифікації. Використовується для цього способу відбору середовищем може бути містить метіонін середовище, яка імітує стану ауксотрофии за аденину умови, переважно мінімальна живильне середовище, доповнена метіоніном у відсутність біотину, иточное зміст серосодержащего з'єднання, можна продукувати за допомогою культивування дріжджів цього винаходу. Переважно дріжджі культивують у живильному середовищі, що містить достатню кількість аденіну, (в умови надлишку аденіну) для проліферації дріжджів і потім культивують у живильному середовищі, в якій вміст аденіну обмежена, (в умови недостатнього змісту аденіну) для підвищення клітинного змісту серосодержащего з'єднання. Таким чином можна ефективно продукувати дріжджі, в яких акумулюється серосодержащие з'єднання.

«Достатня кількість» можна визначити, наприклад, шляхом експериментального вимірювання кількості аденіну, необхідного для отримання заздалегідь визначеного кількості клітин, і розрахунку кількості аденіну, необхідного для отримання бажаної кількості клітин. Наприклад, «достатня кількість» може бути менше 100 мг/л

Живильне середовище для культивування та умови культивування, відмінні від кількості аденіну, можна відповідним чином вибрати, виходячи зі звичайної живильного середовища і умов, що використовуються для культивування нормальних дріжджів. В залежності від властивостей використовуваних дріжджів в середу можна додатково додати нео�тательной середовищі, в якій кількість аденіну обмежена. Переважно така живильне середовище має зміст аденіну, що становить 25 мг/л або менше. Кліткове утримання серосодержащего з'єднання підвищується під час культивування на живильному середовищі, в якій вміст аденіну обмежена.

Переважно культивування припиняють, коли кількість акумульованого серосодержащего з'єднання досягає бажаної кількості. Зазвичай час культивування становить 10-30 годин, переважно 15-27 годин.

Отримані піддані культивування клітини або їх фракціонований продукт містять сірковмісні сполуки. Їх культивування клітин може бути живильне середовище для культивування, що містить дріжджові клітини, або дріжджові клітини, зібрані з середовища для культивування. Фракціонованим продуктом, що містить сірковмісні сполуки, можуть бути клітинні гомогенати або дріжджовий екстракт. Приготування дріжджового екстракту і т. п. можна здійснити способом, однаковим з загальноприйнятим спосіб приготування дріжджового екстракту. Дріжджовий екстракт можна отримати обробкою дріжджових клітин гарячою водою або обробкою дріжджових клітин.� клітин. Сірковмісні сполуки, а також дріжджові клітини та їх фракціонований продукт, що містять сірковмісні сполуки, можна використовувати для одержання продуктів харчування, лікарських засобів, хімічних продуктів, кормів для тварин і т. п. Приклади продуктів харчування включають алкогольні напої, хлібні продукти і смакові речовини ферментованих харчових продуктів. Продукти харчування можна отримати змішуванням сірковмісних сполук, підданих культивування клітин або їх фракціонованого продукту з вихідними матеріалами продуктів харчування і переробкою суміші в продукти харчування.

ПРИКЛАДИ

Нижче даний винахід описується з посиланням на приклади. Але цей винахід не обмежується цими прикладами.

ПРИКЛАД 1

(Виділення ауксотрофних за аденину дріжджів)

Диплоїдний штамSaccharomyces cerevisiaeотримували схрещуванням гаплоїдного штаму AJ14819, який несе мутантний ген МЕТ30 (альфа-тип МАТ), з гаплоидним штамом AJ14810 (тип МАТ). Штам AJ14819, який є чутливим до селенової кислоті штамом, був депонований у Міжнародний депозитарій патентуються організмів, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1, Higashi 1-chome, Tsukuba-shi, Ibara� AJ14810 був депонований у Міжнародний депозитарій патентуються організмів, National Institute of Advanced Industrial Science and Technology 1 листопада 2002 згідно з умовами Будапештського договору і отримав вхідний номер FERM BP-8229. Потім був створений диплоїдний штам для утворення суперечка, і отримали за допомогою листка аналізу наступні гаплоїдні штами:

А: гаплоид, тип МАТ, з мутированним МЕТ30;

В: гаплоид, альфа-тип МАТ, з мутированним МЕТ30;

З: гаплоид, тип МАТ, з МЕТ30 дикого типу;

D: гаплоид, альфа-тип МАТ, з МЕТ30 дикого типу.

Оцінювали рівень експресії гена МЕТ25 в отриманих 4 штами. Ґрунтуючись на способах, описаних у прикладі 1 JP 2004-201677, рівень експресії гена МЕТ25 в цих штамах визначали наступним чином. Кожен штам інокулював в живильне середовище YPD (50 мл у колбі Сакагучі об'ємом 500 мл) і культивували при 30°С з погойдуванням. В логарифмічній фазі росту клітини кожного штаму збирали, і з клітин екстрагували РНК, кількісний рівень експресії гена МЕТ25 визначали, використовуючи ген АСТ1 в якості внутрішнього стандарту. Визначення кількісного рівня проводили з використанням PCR5700 (Applied Biosystems) і набору для ВІД-ПЛР TaqMan One-Step (Applied Biosystems). АСТ1-986Т і МЕТ25-1077Т (JP 2004-201677) використовували як TaqMan-зондів (Applied Biosystems), і в якості праймерів використовували АСТ1-963F і ердили, що рівень експресії гена МЕТ25 в штамі А і штам, обидва з яких мають мутантним геном МЕТ30 і чутливістю до селенової кислоті, вище, ніж у штамі З і штам D, обидва з яких не мають мутантним геном МЕТ30. Штам отримав неофіційний номер AJ14889, а штам А отримав неофіційний номер AJ14890.

Потім штам AJ14889 обробляли мутагеном MNNG (1-метил-3-нітро-1-нитрозогуанидином), так щоб ступінь виживання ставала рівною 5-10%, відповідно з звичайним способом, і оброблені клітини розподіляли по чашках YPD і культивували при 30°С протягом приблизно одного тижня. Серед з'явилися колоній відбирали колонії червоного кольору. Аналіз комплементации проводили стосовно ауксотрофии за аденину отриманих штамів відповідно до загальноприйнятим способом. В результаті отримали два штами, одним з яких був штам N1, який є ауксотрофним за аденину внаслідок мутації в гені ADE1, а іншим штамом був штам N2, який є штамом з неповним блокуванням аденіну внаслідок мутації в гені ADE2. Штами N1 і N2 були депоновані до Всеросійської колекції промислових мікроорганізмів (ВКПМ) (1 Дорожній проїзд, Москва 117545, Росія) 23 грудня 2008 згідно з умовами Будапешт�исокой акумуляцією GSH і інтенсивним червоним кольором)

Штам Y-3218, штам, який має мутацію в гені ADE1, обробляли мутагеном MNNG, так щоб ступінь виживання ставала рівною 5-10%, відповідно з звичайним способом, і оброблені клітини розподіляли по чашці PGC або чашці YPD і культивували при 30°С протягом приблизно одного тижня. Відбирали колонії, демонструють більш інтенсивний червоний колір, ніж колір Y-3218, та вміст GSH порівнювали з вмістом GSH в штамі AJ14889 (вихідний штам) та штам Y-3218. Тобто відібрані штами, а також штам AJ14889 і штам Y-3218 інокулював відповідно в 5 мл рідкого живильного середовища YPD і культивували при 30°С з погойдуванням при 250 обертів/хвилину протягом 24 годин. Потім отриману культуру кожного штаму інокулював в 50 мл рідкого живильного середовища YPD і культивували при 30°С з погойдуванням при 250 обертів/хвилину протягом 24 годин. Вміст GSH в кожному штамі визначали у відповідності із загальноприйнятою процедурою, і в результаті було виявлено, що вміст GSH в штамі Y-3218 вище, ніж вміст GSH в штамі AJ14889 (таблиця 1). Також було виявлено, що серед відібраних штамів (всього 180 штамів) сім штамів мали більш високий вміст GSH, ніж штам Y-3218 (таблиця 1).

GSH (%)
AJ148892,3
Y-32182,8
Y-3218-13,9
Y-3218-23,4
Y-3218-34,5
Y-3218-43,9
Y-3218-54,2
Y-3218-63,4
Y-3218-73,7

Експерименти такого ж роду були виконані з використанням штаму Y-3219, штаму, має мутацію в гені ADE2, замість штаму Y-3218. Штам Y-3219 обробляли мутагеном MNNG, так щоб ступінь виживання ставала рівною 5-10%, відповідно з звичайним способом, і оброблені клітини розподіляли по чашці PGC або чашці YPD і культивували при 30οС протягом приблизно одного тижня. Відбирали колонії, демонструють більш інтенсивний червоний колір, ніж колір Y-3219, та вміст GSH порівнювали з вмістом GSH в штамі AJ14889 (вихідний штам) та штам Y-3219. Тобто відібрані штами, а такжеsup>οЗ погойдуванням при 250 обертів/хвилину протягом 24 годин. Потім отриману культуру кожного штаму інокулював в 50 мл рідкого живильного середовища YPD і культивували при 30οЗ погойдуванням при 250 обертів/хвилину протягом 24 годин. Вміст GSH в кожному штамі визначали у відповідності із загальноприйнятою процедурою, і в результаті було виявлено, що вміст GSH в штамі Y-3219 вище, ніж вміст GSH в штамі AJ14889 (таблиця 2). Також було виявлено, що десять з відібраних штамів (всього 118 штамів) мали більш високий вміст GSH, ніж штам Y-3219 (таблиця 2).

Таблиця 2
Назва штамуGSH (%)
AJ148892,3
Y-32193,0
Y-3219-13,8
Y-3219-23,2
Y-3219-33,5
Y-3219-43,5
Y-3219-53,3
Y-3219-83,4
Y-3219-93,3
Y-3219-103,4

Таблиця 1 і таблиця 2 показали, що було можливим виділення мутантів з більш високим вмістом GSH з використанням в якості показника інтенсивного червоного забарвлення аусотрофии за аденину.

ПРИКЛАД 3

(Виділення білої колонії, має високий вміст GSH)

Колір штаму дріжджів дикого типу не червоний, а білий або біло-жовтуватий. Тому автори цього винаходу намагалися виділити штам, який утворює колонію нормального кольору, з отриманих мутантів інтенсивного червоного кольору. Спочатку штам Y-3219 обробляли мутагеном MNNG таким же чином, як описано в прикладі 2, і оброблені клітини розподіляли по чашці PGC або чашці YPD для отримання мутанта більш інтенсивного червоного кольору. Штам Y-3219-20, представлений у таблиці 3, отримували таким же чином, як описано в прикладі 2. Потім штам Y-3219-20 обробляли мутагеном MNNG, так щоб ступінь виживання ставала рівною 5-10%, відповідно з звичайним способом, і оброблені клітини рас�ий відібрали три білих колонії (Y-3219-20-52, Y-3219-20-53, Y-3219-20-56) і одну червону колонію (Y-3219-20-1), та вміст GSH порівнювали з вмістом GSH в штамі Y-3219 і штамі Y-3219-20. Тобто відібрані штами, а також штами Y-3219 і Y-3219-20 інокулював відповідно в 5 мл рідкого живильного середовища YPD і культивували при 30οЗ погойдуванням при 250 обертів/хвилину протягом 24 годин. Потім отриману культуру кожного штаму інокулював в 50 мл рідкого живильного середовища YPD і культивували при 30°С з погойдуванням при 250 обертів/хвилину протягом 24 годин. Вміст GSH в кожному штамі визначали у відповідності із загальноприйнятою процедурою. Результати представлені в таблиці 3.

Таблиця 3
Назви штамівGSH (%)Колір колонії
Y-32193,0Червоний
Y-3219-203,5Червоний
Y-3219-20-14,3Червоний
Y-3219-20-52Білий
Y-3219-20-564,4Білий

Білі колонії генетично аналізували з використанням штамів-тестерів. В результаті було виявлено, що штам Y-3219-20-52, який мав зменшений вміст GSH, втратив ауксотрофию за аденину. З іншого боці штам Y-3219-20-56, у якому зберігався високий вміст GSH, мав мутацію в гені ADE4, крім мутації в гені ADE2, штам Y-3219-20-53 мав мутацію в гені ADE8, крім мутації в гені ADE2. На підставі цих результатів виявлено, що ауксотрофний за аденину штам, який утворює червону колонію, може бути перетворений в штам, який утворює колонію нормального кольору, шляхом мутирования гена ADE4 або гена ADE8. Штам Y-3219-20-56 був депонований до Всеросійської колекції промислових мікроорганізмів (ВКПМ) (1 Дорожній проїзд, Москва 117545, Росія) 23 грудня 2008 згідно з умовами Будапештського договору і отримав вхідний номер VKPM Y-3256.

ПРИКЛАД 4

(Висока акумуляція GSH, викликана недоліком аденіну)

Досліджували зв'язок між вмістом GSH і недоліком аденіну. Штам Y-3256 культивували в 50 мл живильного середовища YPD (20 г/л D-глюкози, 20 г/л бактопептона, 10 г/л дріжджового екстракту),�ученную культуру інокулював в 50 мл живильного середовища YPD, міститься в колбі Сакагучі об'ємом 500 мл, доповненої різними концентраціями аденіну (кінцева концентрація аденіну 0 мг/л, 10 г/л, або 20 г/л), щоб зробити вихідну оптичну щільність при 660 нм дорівнює 0,1, і культивували при 30°С з погойдуванням при 120 обертів/хв. Таблиця 4 демонструє тимчасової курс вмісту GSH.

Таблиця 4
16 годину (%)20 годин (%)24 год (%)
Аденін 0 мг/л3,885,485,30
Аденін 10 мг/л3,694,364,36
Аденін 20 мг/л3,203,483,50

Ці результати вказують на те, що вміст GSH в ауксотрофном за аденину штамі Y-3256 обернено пропорційно концентрації аденіну в живильному середовищі. Слід зазначити, що штам Y-3256 може рости в живильному середовищі YPD без доповнення пекло аналізом зміст аденіну в середовищі YPD становить приблизно 10 мг/л).

ПРИКЛАД 5

(Оцінка в широкогорлом біореакторі)

Штам Y-3256 культивували в широкогорлом біореакторі, і оцінювали тимчасової курс вмісту GSH в штамі Y-3256. Клітини штаму брали з агаризованому твердої живильного середовища YPD і інокулював в три конічні колби об'ємом 750 мл, що містять 50 мл рідкого живильного середовища YPD, і культивували при 30°С з погойдуванням при 250 обороти/хв протягом 20 годин. Отриману посівну культуру (120 мл) інокулював у 1,2 л живильного середовища для основного культивування (середовища YPD), що міститься в широкогорлом біореакторі об'ємом 3 л, і культивування проводили при 30°С з погойдуванням при 1100 обертах/хв. Живильне середовище аэрировали зі зміною 1/1 (об'єм/об'єм)/хв, рН регулювали водним аміаком так, щоб він становив 6. Подається живильне середовище подавали зі швидкістю 1,5 мл/годину в межах від 0 до 24 годин, і потім зі швидкістю 1,8 мл/год. Склад подається середовища включав 600 г глюкози, 10 г бактодрожжевого екстракту, 10 г кукурудзяного екстракту, 10 г бактопептона, 0,274 р (NH4)2SO4, 0,11 г KH2PO4, 0,732 м KCl, 0,466 р MgSO4, 0,0012 г CuSO4, 0,014 г ZnSO4, 0,00334 р MnSO4, 0,00012 р NaMoO4, 0,002 м KCl, 0,00004 р H3B03, 0,0001 г CoSO4, 0,28 г CaCl�й курс змісту GHS в штамі Y-3256.

ПРИКЛАД 6

(Отримання диплоїдного штаму і дослідження складу живильного середовища)

У відповідності із загальноприйнятим способом отримували гомодиплоидний штам Y-3219-20-53. Експериментальними умовами були наступні умови. Штам Y-3219-20-53 обробляли мутагеном MNNG, так щоб ступінь виживання ставала рівною 5-10%, відповідно з звичайним способом, і оброблені клітини розподіляли по твердому агаризованому живильному середовищі YPD так, щоб з'явилося 100-200 колоній. Після культивування при 30οС протягом п'яти днів колонії передруковували на агаризованому тверду живильне середовище SD, доповнену аденином, і на агаризованому тверду живильне середовище YPD, і відібрали штам, який міг рости на живильному середовищі YPD, але не міг рости на живильному середовищі SD, доповненої аденином. Визначали ауксотрофию, відмінну від ауксотрофии за аденину, і отримали штам Y-3219-20-53-aux1 і штам Y-3219-20-53-aux2, які мали відмінні один від одного аусотрофиями. Робили посів вертикальними штрихами штаму Y-3219-20-53-aux1 на агаризованому тверду живильне середовище SD, доповнену аденином, і робили посів горизонтальними штрихами штаму Y-3219-20-53-aux2 на ту ж агаризованому тверду живильне середовище SD, доповнену адениЃю живильне середовище SD, доповнену аденином, інкубували при 30οС протягом 20 днів, і відібрали колонію, яка з'явилася в точці перетину. Таким чином отримали аусотрофний за аденину диплоїдний штам D1-3. Штам D1-3 був депонований до Всеросійської колекції промислових мікроорганізмів (ВКПМ) (1 Дорожній проїзд, Москва 117545, Росія) 23 грудня 2008 згідно з умовами Будапештського договору і отримав вхідний номер VKPM Y-3309. При посіві штрихами штаму D1-3 на агаризованому тверду живильне середовище SD, доповнену аденином, і культивуванні при 30°С протягом 5 днів утворювалися колонії, так що було підтверджено, що цього штаму не була надана аусотрофия, відмінна від аусотрофии за аденину.

Диплоїдний штам Dip був отриманий в якості контрольного не є аусотрофним за аденину штамом схрещуванням штаму AJ14889 зі штамом AJ14890.

Штам D1-3 і штам Dip інокулював в 5 мл рідкого живильного середовища YPD, що міститься в пробірці, і культивували при 30°С протягом 24 годин з погойдуванням при 250 обертах/хв. Отриману культуру інокулював в 50 мл кожній з живильних середовищ, представлених в таблиці 5, і культивування проводили при 30°С протягом 24 годин з погойдуванням при 250 обертах/хв. Визначали �подано в таблиці 6.

Таблиця 5
Номер середовищаПептон (г/л)Дріжджовий екстракт (г/л)Глюкоза (г/л)
I10520
II51020
III01020
IV02020

Таблиця 6
I: GSH(%)II: GSH(%)III: GSH(%)IV: GSH(%)
D1-34,65,18,66,3
Dip3,2

Ці дані показують, що аусотрофия за аденину може підвищити вміст GSH при використанні кожної з поживних середовищ.

ПРИКЛАД 7

(Отримання аусотрофних за аденину дріжджів з високим вмістом γ-глутамилцистеина і оцінка підвищеного вмісту γ-глутамилцистеина)

Ген GSH2, що кодує глутатионсинтетазу, піддавали руйнування в штамі Y-3256, отриманому в прикладі 3, для отримання гаплоїдного штаму, який акумулює γ-глутамилцистеин. Для конструювання касети для руйнування гена GSH2 проводили ПЛР, використовуючи праймери SEQ ID NO: 17-22 і геномну ДНКS. cerevisiae(штаму дикого типу) і плазміду pFA6a-KanMX6 (Chiara et al., Yeast 2000; 16: 1089-1097) в якості матриць (фіг. 2). Детальними умовами були наступні умови.

Спочатку ампліфікували 5'-район розміром приблизно 400 п. о. від відкритої рамки зчитування (ОРС) GSH2 з геномної ДНК Х2180-1В (штаму дикого типуS. cerevisiae, доступного з АТСС, з вхідним номером АТСС204505) для отримання 5'-фрагмента GSH2, використовуючи праймер GSH2-up-F (SEQ ID NO: 17) і праймер GSH2-up-R (SEQ ID NO: 18). 5'-фрагмент GSH2 мав послідовність сайту для ферменту рестрикції BpiI на одному кінці і послідовність con1 для ПЛР зі злиттям, яка описується пізніше, на іншому кінці узгодж від ОРС GSH2 з геномної ДНК Х2180-1ВS. cerevisiaeдля отримання 3'-фрагмента GSH2, використовуючи праймер GSH2-down-F (SEQ ID NO: 19) і праймер GSH2-down-R (SEQ ID NO: 20). 3'-фрагмент GSH2 мав послідовність con2 для ПЛР зі злиттям, яка описується пізніше, на одному кінці і послідовність сайту для ферменту рестрикції BpiI на іншому кінці згідно конструкції праймера GSH2-down-F і праймера GSH2-down-R. Потім за допомогою ПЛР ампліфікували ген KanMX з плазміди pFA6a-KanMX6, використовуючи праймер Marker-F (SEQ ID NO: 21) і праймер Marker-R (SEQ ID NO: 22). Цей амплифицированний за допомогою ПЛР фрагмент гена KanMX мав послідовність con1 на одному кінці і послідовність con2 на іншому кінці для ПЛР зі злиттям згідно конструкції праймера Marker-F і праймера Marker-R. Ці три ампліфікації за допомогою ПЛР проводили при наступних умовах. Для кожної реакції використовували суміш ДНК-полимераз (Pfu:Taq = 1:10, обидві з яких доступні від Fermentas, Литва). ПЛР проводили повтором 30 разів циклу, що складається з 94°С протягом 30 секунд, 50°З протягом 30 секунд і 68°С протягом 3 хвилин.

Потім ці три отриманих фрагмента піддавали лигированию для отримання касети для руйнування гена GSH2 за допомогою ПЛР зі злиттям. ПЛР зі злиттям проводили, використовуючи праймер GSH2-up-F і праймер Marker-R в якості праймерів для ПЛР і 5'-фрагмента GSH2 і фрагм�ть con1 на своїх кінцях, 5'-фрагмент GSH2 і фрагмент гена KanMX піддавалися лигированию, і за допомогою цієї ПЛР зі злиттям був отриманий фрагмент (5'-фрагмент GSH2)-(фрагмент гена KanMX). Цю ПЛР зі злиттям проводили з використанням тієї ж суміші ДНК-полимераз. ПЛР проводили повтором 5 разів циклу, що складається з 94°С протягом 30 секунд, 61°З протягом 30 секунд і 68°С протягом 4,5 хвилин, і потім повтором 25 разів циклу, що складається з 94°С протягом 30 секунд, 50οЗ протягом 30 секунд і 68οС протягом 4,5 хвилин. Потім провели іншу ПЛР зі злиттям, використовуючи праймер GSH2-up-F і праймер GSH2-down-R в якості праймерів для ПЛР і фрагмент (5'-фрагмент GSH2)-(фрагмент гена KanMX) і 3'-фрагмент GSH2 в якості матриць. Оскільки фрагмент (5'-фрагмент GSH2)-(фрагмент гена KanMX) і 3'-фрагмент GSH2 мають однакову послідовність con2 на своїх кінцях, фрагмент (5'-фрагмент GSH2)-(фрагмент гена KanMX) і 3'-фрагмент GSH2 піддавалися лигированию, і була отримана касета для руйнування гена GSH2. Цю ПЛР зі злиттям проводили з використанням тієї ж суміші ДНК-полимераз. ПЛР проводили повтором 5 разів циклу, що складається з 94°С протягом 30 секунд, 61°З протягом 30 секунд і 68°С протягом 5,3 хвилин, і потім повтором 25 разів циклу, що складається з 94°С протягом 30 секунд, 50°З протягом 30 секунд і 68°С течGAAGACCTTCGTTTGGTGTTATGGT (SEQ ID NO: 17)

(2) GSH2-up-R, GAGAGGGGGGGGGTGGGGGGAAGGTGGATAGTGTGCC (SEQ ID NO: 18)

(3) GSH2-down-F, CCTCCTCCCCCCGCCCACGGCAGGATTCGGATGTTTG (SEQ ID NO: 19)

(4) GSH2-down-R, CGAAGACTCAGTACGAGCATTACGCAA (SEQ ID NO: 20)

(5) Marker-F, 5`-CCCCACCCCCCCCCTCTCTACCGTTCGTATAATGTATGCTATACGAAGTTATACTGGATGGCGGCGTTAG (SEQ ID NO: 21)

(6) Marker-R, GTGGGCGGGGGGAGGAGGTACCGTTCGTATAGCATACATTATACGAAGTTATGTTTAGCTTGCCTCGTCC (SEQ ID NO: 22)

Штам Y-3256 трансформували касетою для руйнування гена GSH2 для виклику гомологічної рекомбінації, і трансформантів розподіляли по твердому агаризованому живильному середовища YPD, що містить G418 (50 мкг/мл). Серед з'явилися колоній був отриманий штам N8ΔGSH2, в якому зруйнований ген GSH2.

Штам N8ΔGSH2 культивували в 50 мл живильного середовища YPD (20 г/л D-глюкози, 20 г/л бактопептона, 10 г/л дріжджового екстракту), що міститься в колбі Сакагучі об'ємом 500 мл, при 30°С з погойдуванням при 120 обороти/хв протягом 24 годин, і отриману культуру інокулював в 50 мл живильного середовища YPD, що міститься в колбі Сакагучі об'ємом 500 мл, доповненої різними концентраціями аденіну (кінцева концентрація аденіну 0 мг/л, 10 г/л, або 20 г/л), щоб зробити вихідну оптичну щільність при 660 нм дорівнює 0,1, і культивували при 30°С з погойдуванням при 120 обертів/хв. Концентрацію γ-глутамилцистеина визначали згідно з загальноприйнятим способом. Таблиця 7 демонструє тимчасової кѸем ауксотрофии за аденину.

Таблиця 7
16 годину (%)20 годин (%)24 год (%)40 год (%)
Аденін 0 мг/л1,992,412,622,92
Аденін 10 мг/л1,741,862,212,42
Аденін 20 мг/л1,451,531,642,22

ПРИКЛАД 8

(Оцінка на живильному середовищі, що імітує стану ауксотрофии за аденину)

У відповідності із загальноприйнятим способом штам AJ14889 піддавали обробці мутагеном MNNG, внаслідок чого коефіцієнт виживання ставав рівним приблизно 10%, і оброблені клітини розподіляли по чашці з агаризованому середовищем min-met(+)-biotin(-), яка містить представлені в таблиці 8 компоненти і метіонін в концентрації 150 мг/л, всієї серед колоній, з'явилися на 30 планшетах, було відібрано 106 колоній від світло-рожевого до червоного кольору.

Потім визначали внутрішньоклітинний вміст GSH у відібраних штамах і штамі AJ14889 (вихідний штам) при їх культивування на живильному середовищі YPD. Тобто відібрані штами, а також штам AJ14889, піддані культивування на чашки з поживним середовищем YPD, інокулював відповідно в 5 мл рідкого живильного середовища YPD, що міститься в пробірці, і культивували при 30°С з погойдуванням при 250 обертів/хвилину протягом 24 годин. Потім отриману культуру кожного штаму інокулював в 50 мл рідкого живильного середовища YPD, що міститься в конічній колбі об'ємом 750 мл, так щоб оптична щільність при 600 нм дорівнює 0,1, і культивували при 30°С з погойдуванням при 250 обертів/хвилину протягом 24 та 48 годин, відповідно. В результаті було встановлено, що серед 106 відібраних штамів вісім штамів демонструють вміст GSH, перевищує вміст GSH в штамі AJ14889 (таблиця 9) через 24 і/або 48 годин. Встановлено, що цей спосіб відбору є дуже ефективним для одержання штаму, що має високий вміст GSH, оскільки вісім штамів серед 108 штамів продемонстрували підвищений вміст GSH.

Складmin-met(+)-біотин(-)Основа (г/л)K2HPO40,15KH2PO40,85MgSO40,5NaCl0,1CaCl20,1(NH4)2SO43,5Глюкоза20Вітамін (мг/л)Біотин0Пантотенат кальцію2,0Фолієва кислота0,002Інозит10Ніацин (нікотинова кислота)0,4РАВА (D-амінобензойна кислота)Рибофлавін0,2Тіаміну гідрохлорид0,4Мікроелементи (мг/л)Борна кислота0,5CuSO40,04KI0,1FeCl30,2MnSO40,4Na2MoO40,2ZnSO40,4

Таблиця 9
ШтамиЗміст GSH через 24 год (%)Зміст GSH через 48 год (%)
AJ148892,32,3
89-62,83,3
89-132,22,7
89-282,63,3
89-312,73,0
89-332,33,0
89-693,12,6
89-1002,42,9

Потім з групи з восьми штамів було відібрано штам 89-6, штам 89-28 і штам 89-31, і їх зростання та вміст GSH порівнювали з зростанням та вміст GSH в штамі AJ14889. Ці штами культивували, як описано вище, за винятком того, що клітини інокулював так, щоб оптична щільність при 600 нм дорівнює 0,3. Зростання визначали на основі сухого клітинного ваги (DCW). Як продемонстровано у таблиці 10, три штами продемонстрували майже таке ж зростання, як і штам AJ14889, та вміст GSH, перевищує вміст GSH в штамі AJ14889 через 24 і 48 годин.

Таблиця 10
DCW(г/л)GSH(%)DCW(г/л)GSH (%)
AJ148897,002,37,672,3
89-65,832,86,003,6
89-286,882,57,133,5
89-316,482,67,273,4

Для дослідження ймовірності того, що цим трьом штамів була надана несподівана здатність - ауксотрофия за живильного речовини, ці три штами і штам AJ14889 інокулював в живильне середовище SD, і визначали їх зростання. Конкретно, штами, піддані культивування на чашки з поживним середовищем YPD, інокулював відповідно в 5 мл живильного середовища SD, що міститься в пробірці, і культивували при 30°С з погойдуванням при 250 обертах/мії таким же, як і ріст штаму AJ14889 в середовищі SD (таблиця 11), що означає, що цим трьом штамам не була надана несподівана здатність - ауксотрофия за живильного речовини.

Таблиця 11
DCW через 24 год (г/л)DCW через 48 год (г/л)
AJ148892,02,33
89-61,332,33
89-282,172,67
89-312,332,49

ПРОМИСЛОВА ПРИДАТНІСТЬ

У відповідності з цим винаходом надаються ауксотрофние за аденину дріжджі, що мають підвищений вміст серосодержащего з'єднання в клітинах, спосіб відбору дріжджів і спосіб культивування дріжджів. Даний винаходу може широко використовуватися в області продуктів харчування, лікарських засобів, хімічних продуктів, кормів для тварин і т. п.

1. Спосіб отримання ін� з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина, порівняно з батьківським штамом дріжджів який демонструє ауксотрофию за аденину і має модифікацію для посилення експресії гена МЕТ25, що включає:
завідоме поставлення батьківського штаму обробці агентом для мутагенезу,
розподіл модифікованих дріжджів у живильному середовищі, що має зміст аденіну 25 мг/л або менше, для утворення колоній дріжджів,
відбір колонії дріжджів, яка красно порівняно з батьківським штамом до модифікації та
відбір дріжджів, мають підвищений кліткове утримання зазначеного серосодержащего з'єднання порівняно з батьківським штамом.

2. Спосіб за п. 1, в якому зазначені дріжджі додатково модифіковані для зниження міжклітинної активності глутатіон-синтетази.

3. Спосіб отримання дріжджів, мають підвищений кліткове утримання серосодержащего з'єднання, вибраного з групи, що складається з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина, порівняно з батьківським штамом дріжджів який демонструє ауксотрофию за аденину і має модифікацію для посилення експресії гена МЕТ25, що включає:
завідоме поставлення батьківського штаму обробці а�ної метіоніном, для утворення колоній дріжджів,
відбір колонії дріжджів, яка красно порівняно з батьківським штамом до модифікації та
відбір дріжджів, мають підвищений кліткове утримання зазначеного серосодержащего з'єднання порівняно з батьківським штамом.

4. Спосіб за п. 3, в якому зазначені дріжджі додатково модифіковані для зниження міжклітинної активності глутатіон-синтетази.

5. Спосіб отримання серосодержащего з'єднання, вибраного з групи, що складається з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина, що включає культивування дріжджів, отриманих способом по кожному з пп. 1-4.

6. Спосіб за п. 5, в якому зазначені дріжджі культивують у багатих аденином умовах при вмісті аденіну 100 мг/л або більше для збільшення кількості дріжджових клітин, а потім культивують у бідних аденином умовах при вмісті аденіну 25 мг/л або менше для збільшення клітинного змісту серосодержащего з'єднання, вибраного з групи, що складається з цистеїну, γ-глутамилцистеина, глутатіону і цистеинилглицина.



 

Схожі патенти:
Винахід відноситься до галузі біохімії. Запропоновано спосіб отримання білкового інгредієнта. Залишкові пивні дріжджі попередньо розбавляють водою у співвідношенні 1:1 і центрифугують. Отриманий осад обробляють гідроксидом натрію, далі осад повторно розбавляють водою у співвідношенні 1:2 і концентрують центрифугуванням. Після осад нейтралізують соляною кислотою і заморожують в льодогенераторі безперервної дії, гомогенізують, розбавляють водою у співвідношенні 1:2, концентрують центрифугуванням і сушать в сушильному агрегаті. Винахід забезпечує підвищення біологічної цінності добавки. 6 пр.

Спосіб отримання настою чайного гриба

Винахід відноситься до способу отримання настою чайного гриба. Спосіб передбачає культивування мікроорганізму Medusomyces Gisevii Lindau в умовах аерації при 23-25°C углеводсодержащей середовищі, при цьому в якості джерела вуглеводів і стимулятора росту використовують висушений гомогенат підмору бджіл з розрахунку 8-10 г на 1 л поживного середовища. Винахід дозволяє прискорити дозрівання кінцевого продукту і накопичення біомаси мікроорганізму-продуцента, а також поліпшити смакові якості одержуваного продукту. 1 табл., 9 пр.

Штам дріжджів saccharomyces bayanus

Штам дріжджів Saccharomyces bayanus IMB Y-5022 для виробництва ігристих вин резервуарним способом відноситься до виробництва ігристих вин періодичним способом з білих, червоних і рожевих сортів винограду при вторинному бродінні в акратофорах. Результати, отримані при зброджуванні акратофорною суміші, свідчать про високої бродильної активності запропонованого штаму Saccharomyces bayanus IMB Y-5022 в умовах, несприятливих для вторинного бродіння: низький рН, висока ступінь сульфітації. В цих умовах тривалість вторинного бродіння скоротилася на 9-14 діб. Штам дріжджів відрізняється наступними цінними ознаками: високою конкурентоспроможністю; підвищеною стійкістю до діоксиду сірки (зброджування акратофорною суміші при вмісті вільного діоксиду сірки 35±5мг/дм3 в 4 добу); активно сбраживает акратофорную суміш при температурі 12±2°С; кислотостійкий (pH 2,7, оптимум 3,0-3,2).
Винахід відноситься до біотехнології, а саме до області культивування мікроорганізмів для одержання кормових продуктів, і може бути використано в промисловості для одержання біомаси каротинсинтезирующих дріжджів як джерела каротиноїдів. Спосіб передбачає культивування культури мікроорганізму, в якості якого використовують дріжджі Rhodotorula glutinis МКПМ Y-608 при концентрації пероксиду водню в ферментаційної середовищі 5,0 - 6,5 г/л, внесеного на 24-27 годину культивування, і витримку не менше 2 годин з одержанням цільового продукту. Винахід дозволяє підвищити вихід каротиноїдів. 3 табл.,29 пр.
Винахід відноситься до біотехнології. Спосіб отримання α-кетоглутаровой кислоти передбачає аеробне культивування на живильному середовищі штам дріжджів Yarrowia lipolytica BKM Y-2412. Середовище має наступний склад (г/л): ріпакова олія - 20; (NH4)2SO4 - 6, MgSO4×7H2O - 1,4, Ca(NO3)2 - 0,8, NaCl - 0,5, КН2РО4 - 2,0, K2HPO4 - 0,2, мікроелементи (мг/л): KJ - 0,1, В3+ - 0,01, Mn2+ - 0,01, Zn2+ - 0,01, Cu2+ - 0,01, Мо2+ - 0,01, Fe2+ - 1,2 мг/л, тіамін - 1,2 мкг/л, вода дистильована - до 1 л. При цьому додатково вводять сульфат амонію по 1,2 г/л через кожні 20-30 год культивування. Перший етап зростання біомаси проводять протягом 44-48 год, при рн 4,1-5,0, аерації на рівні 20-25% від насичення. На другому етапі культивування в період з 44-48 год до 70-72 год pH підтримують на рівні 4,1-5,0. На третьому етапі культивування в період з 70-72 год до 188-192 год знижують рівень pH до 3,0-4,0. Додатково на другому і третьому етапах контролюють рівень концентрації розчиненого у середовищі кисню pO2, додають ріпакова олія по 20 г/л при збільшенні концентрації розчиненого у середовищі кисню pO2 вище 10%, а також збільшують величину аерації до 50-55% від рівня насичення. Винахід дозволяє підвищити вихід α-кетоглутаровой кислоти до 102,5 г/л. 1 табл., 2 пр.
Група винаходів відноситься до галузі біотехнології. Запропоновано штами Cryptococcus flavescens 3C NRRL Y-50378 і Cryptococcus flavescens 4С NRRL Y-50379 для придушення і контролю фузаріозу злаків, що володіють стійкістю до протиоконазолу. Для придушення фузаріозу в колос злаку вносять штам Cryptococcus flavescens 3C NRRL Y-50378 або штам Cryptococcus flavescens 4С NRRL Y-50379, або комбінацію зазначених штамів в кількості, достатній для зниження рівня фузаріозу порівняно з рівнем, що спостерігаються для необробленого контролю. Також запропонована композиція для придушення фузаріозу злаків, що включає штам Cryptococcus flavescens 3C NRRL Y-50378 або штам Cryptococcus flavescens 4С NRRL Y-50379, або комбінацію зазначених штамів, і агрономічно прийнятний носій. Запропоновані штами Cryptococcus flavescens є ефективними антагоністами F. graminearum. 4 н. і 6 з.п. ф-ли, 3 табл., 1 пр.

Спосіб отримання порошкоподібної селенсодержащей кормової добавки з пивних дріжджів

Винахід відноситься до галузі біохімії. Запропоновано спосіб отримання порошкоподібної селенсодержащей кормової добавки з пивних дріжджів. Спосіб включає розведення пивних дріжджів водою у співвідношенні 1:3, відділення промивної води через сепаратор. Після відділення здійснюють процес обезгорчивания, для чого суспензію дріжджів змішують у співвідношенні 1:1 з 2,0%-ним розчином бікарбонату натрію. Після обезгорчивания здійснюють процес автолізу - суспензію дріжджів розводять водою у співвідношенні 1:1 при температурі 55-65°С і рН 5-7. В розрідженню дріжджову масу вносять розведений водою у співвідношенні 1:15 ферментний препарат Церемикс 6Х MG в кількості 0,3 кг на тонну дріжджів, перемішують і залишають на 20 хв. Далі вносять селеніт натрію в кількості 0,33 г/т, отриману суміш витримують при температурі 55-65°С протягом 4-5 ч. Отриманий гідролізат направляють на розпилювальну сушарку з температурою кондиційованого сушильного агента 80-85°С і вмістом вологи 0,06-0,065 кг/кг. Після сушіння отриманий порошок селенсодержащей добавки з вологістю 4-5% упаковують, залишають для зберігання і використовують в якості кормової добавки для сільськогосподарських тварин і птиці. Винахід дозволяє підвищити ів пивоварного виробництва, покращити екологічність, знизити втрати дріжджів з відходами виробництва, збільшити тривалість зберігання добавки, поліпшити однорідність розподілу селену в комбікормах. 2 табл.

Штам дріжджів saccharomyces cerevisiae мкпм y-3973 для отримання плодово-ягідних вин

Винахід відноситься до виноробної промисловості. Штам дріжджів Saccharomyces cerevisiae «Айвовий-Д» депоновано в Всеросійської Колекції Промислових Мікроорганізмів (ВКПМ), ФГУП Держндігенетика під реєстраційним номером Y-3973. Штам Y-3973 володіє здатністю до спорообразованию, сбраживает і засвоює глюкозу, сахарозу, мальтозу, галактозу, 1/3 раффинози. Штам дріжджів Saccharomyces cerevisiae МКПМ Y-3973 володіє високої бродильної активності, добре сбраживает айвове сусло з вмістом цукру 14,75 г/100 см3, при цьому накопичуючи 8,79% про. етанолу. Штам здатний більш повно засвоювати вуглеводи з великим утворенням етанолу на 0,79% об., чим відомий за однаковий період бродіння. Виноматеріал, отриманий з використанням штаму Saccharomyces cerevisiae Y-3973, відрізняється більш тонким ароматом і смаком. Винахід дозволяє отримувати при температурі бродіння 20ºС натуральні плодово-ягідні вина високої якості. 1 табл., 1 іл., 1 пр.

Рекомбінантна плазмидная днк pcpbh для біосинтезу поліпептиду з властивостями карбоксипептидази б людини, і рекомбінантний штам метилотрофних дріжджів pichia pastoris - продуцент поліпептиду з властивостями карбоксипептидази б людини

Винахід відноситься до галузі біотехнології. Представлена рекомбінантна плазміда рСНВН для експресії у Pichia pastoris послідовності, що кодує прокарбоксипептидазу Б, має розмір 10466 т.п.о і складається з XhoI/EcoRI - фрагмента ДНК вектора рР1С9К розміром 9246 т.п.о. і XhoI/EcoRI - фрагмента ДНК розміром 1220 т.п.о., що включає ділянку, що кодує сигнальний пептид α-фактора Saccharomyces cerevisiae, і синтетичний ген прокарбоксипептидази Б людину з нуклеотидної послідовністю, відповідній послідовності, представленої на фіг.2. Крім того, описаний рекомбінантний штам Pichia pastoris GS115СРВН - продуцент прокарбоксипептидази Б людини, який отримано в результаті трансформації батьківського штаму зазначеної плазміди. Винахід дозволяє отримати прокарбоксипептидазу Б людини і відповідну їй активну форму у збільшеній кількості, що становить не менше 9,0 од/мл, в порівнянні з прототипом. 2 н.п. ф-ли, 4 іл., 4 пр.

Пробіотичні мікроорганізми, збагачених органічним селеном на базі з'єднань гідроксикислот селену, та їх застосування в харчуванні, косметиці і фармації

Група винаходів відноситься до біотехнології. Запропоновано спосіб збагачення пробіотичних мікроорганізмів, виділених з дріжджів і бактерій, органічним селеном. При цьому мікроорганізм культивують на середовищі, що містить з'єднання загальної формули (Іа) або його сіль, стереоизомер або суміш стереоизомеров в будь-яких співвідношеннях або його ефірний похідне. Запропоновані також пробіотичні бактерії, збагачених органічним селеном, з вмістом органічного селену понад 50 мкгSe/р по сухій вазі, а зміст селенметионина становить більш ніж 50% від загального вмісту селену в бактерії. Запропоновано також застосування збагачених зазначеним чином пробіотичних бактерій в косметичному, фармацевтичному або харчовому продукті. Винахід забезпечує збагачення пробіотичних мікроорганізмів нетоксичним органічним селеном з підвищеним виходом. 5 н. і 7 з.п. ф-ли, 6 іл., 4 табл., 4 пр.
Up!