Набір синтетичних олігонуклеотидів для визначення нуклеотидної послідовності кодуючої частини гена des і виявлення мутацій, асоційованих з десминовими кардіоміопатіями

 

Даний винахід відноситься до галузі медицини, зокрема до кардіології та молекулярної біології і може бути використано для виявлення мутацій кодуючої частини гена десмина (DES), асоційованих з кардіоміопатіями різної природи, для визначення тактики ведення хворих десминовой кардіоміопатією та оцінки ризиків розвитку захворювання при виявленні сімейних десминових кардіоміопатій.

Мутації кодуючої частини гена DES є причиною приблизно 2% всіх кардіоміопатій, до 70% десминових кардіоміопатій мають сімейний характер. Рання діагностика таких станів дозволить підбирати своєчасне і адекватне лікування.

Кардіоміопатії - хронічні захворювання міокарда, що супроводжуються порушенням функції серця. Одним з генів, описаних у зв'язку з розвитком дилатаційної кардиомиоптии, є ген десмина (DES). Десмин, білок цитоскелета, відноситься до групи проміжних філаментів. Він експресується в усіх трьох типах м'язової тканини - гладкою, серцевої і поперечно-смугастої скелетної, будучи основним представником групи проміжних філаментів у зрілих м'язових клітинах. Фенотиповим проявом мутацій гена DES може бути кардіоміопатія илиіп myopathy. Brain, Vol.127, Pages 723-734].

Мутації гена DES можуть бути причиною розвитку дилатаційної кардіоміопатії і обумовлюють розвиток захворювання приблизно в 2% випадків [Taylor MR, Slavov D, k u L Di Lenarda A, Sinagra G, Carniel E, Haubold K, Boucek MM, Ferguson D, Graw SL, Zhu X, Cavanaugh J, Sucharov CC, Long CS, Bristow MR, Lavori P, Mestroni L (2007) Prevalence of desmin mutations in dilated cardiomyopathy. Circulation, Vol.115, No 10, Pages 1244 - 1251; Kostareva A, Gudkova A, Sjoberg G, Кисельов I, Moiseeva O, Karelkina E, Goldfarb L, Schlyakhto E, Sejersen T. (2006) Desmin mutations in a St. Petersburg cohort of cardiomyopathies. Acta Myologica, Vol.25, No 3, Pages 109-115].

Виявлення генетичної детермінованості, своєчасна діагностика і лікування асимптоматических пацієнтів з кардіоміопатіями - важкими хронічними захворюваннями серця, мають поганий прогноз та високу летальність, - є важливими для поліпшення прогнозу захворювання та виживання хворих.

Оскільки одним з проявів кардіоміопатій, викликані мутаціями кодуючої частини гена DES, є порушення функціонування провідної системи серця і виникнення атріовентрикулярних блокад, своєчасне виявлення мутацій гена DES з допомогою генетичних методів дослідження дозволить своєчасно визначити тактику ведення хворого та визначити показання до постановки електрокардіостимулятора.

Десмин - цитоскелетний білок з ної тканини. Ген десмина (DES) розташовується на довгому плечі 2-ї хромосоми (2q35). У 1996 році послідовність гена була розшифрована, а пізніше було доведено зв'язок мутацій десмина з дистальної міопатію і кардіоміопатією. Ген складається з 9 екзонів, які розташовані на ділянці 8363 пар основ, і є висококонсервативним серед хребетних. Десмин експресується в поперечносмугастих і гладких м'язах, а також в міокарді.

До теперішнього часу описано понад 40 мутацій кодуючої частини гена DES, більшість з яких локалізовані в З-термінальної частини білка, що відповідає 5-му і 6-му экзонам.

Виявлення мутацій кодуючої частини гена DES рекомендовано для використання у практичній охороні здоров'я у хворих різними видами кардіоміопатій для визначення генетичної причини захворювання. Проте в даний час в рутинній практиці медичних лабораторій не проводиться скринінг мутацій кодуючої частини гена DES, оскільки всі відомі способи визначення послідовності кодуючої частини гена DES вимагають великих витрат часу, включають велику кількість маніпуляцій і призводять до великої кількості помилок із-за складності постановки реакцій.

З рівня техніки відомий сп WA, Hill R, Bachinski LL, Mann DL, Roberts R (1999) Desmin Mutation Responsible for Idiopathic Dilated Cardiomyopathy. Circulation; Vol.100, No 5, Pages 461-464. При здійсненні цього способу геномну ДНК виділяють із зразків крові пацієнтів, застосовуючи стандартну методику виділення ДНК. На виділеної ДНК проводять ампліфікацію методом полімеразної ланцюгової реакції (ПЛР) з використанням 7 синтетичних пар нуклеотидів, званих також праймерами, сконструйованих для 9 екзонів гена десмина. Послідовності праймерів наведено нижче:

exon 1F, CTGATGTCAGGAGGGATACA;

exon 1R, AGAAGGCAGGTGGTGACAG;

exon 2-3F, CTTTATCACCCGCAACTGTC;

exon 2-3R, TATTCCCAGCCAGAGCCTC;

exon 4-5F, AGGCTCTGGCTGGGAATAG;

exon 4-5R, ATGGCCAAGGTCACAAAGTG;

exon 6F, TTTGGGCTGCTAGTGTCCTC;

exon 6R, ATCAGTAATCTCGAGCCTCC;

exon 7F, ATGGTCTCGATCTCCTGACC;

exon 7R, CCCTTTTCTTCCCTAGCTC;

exon 8F, GAAGTAACAAGCCTGTCTTG;

exon 8R, GATCTCTCTTGCCCACTAGC;

exon 9F, CGTCATCCTGCTAGCACATG;

exon 9R, CTGGCAGTCAAGACAACAGG.

ПНР проводять з використанням 200 нг геномної ДНК, в присутності 20 ммоль/л Tris-HCl (рН 8,4), 50 ммоль/л KCl, 1,5 ммоль/л MgCl2, 50 мкмоль/л кожного деоксинуклеотидтрифосфата, 0,2 мкмоль/л прямого праймера, 0,2 мкмоль/л зворотного праймера, 2,5 од. Taq-полімерази в кінцевому об'ємі 50 мкл. Для кожної пари праймерів підбирають свої умови ПЛР - час і температуру відпалу. У результаті ПЛР отримують фрагменти ДНК розміром 709, 385, 621, 361, 299, 329, і 859 пар осруют на генетичному аналізаторі ABI 310 (Applied Biosystems) за допомогою набору реагентів «Big Dye Terminator sequencing kit» компанії Perkin-Elmer і зазначених вище праймерів.

Однак цей спосіб дуже трудомісткий і займає багато часу: з-за різної температури і часу відпалу, ПЛР для кожної пари праймерів потрібно проводити окремо. На стадії внесення реагентів у мікропланшет для проведення секвенування багато часу йде на перевірку відповідності внесених праймерів та продуктів ампліфікації. На цьому етапі допускається основна маса помилок, що призводять до необхідності проведення повторного визначення послідовності кодуючої частини гена DES. Ці особливості роблять неможливим широке застосування цього способу в рутинній лабораторній практиці для скринінгу мутацій кодуючої частини гена DES.

З рівня техніки не виявлено прототип даного винаходу.

Технічним результатом, на досягнення якого спрямовано винахід, є скорочення часу, що витрачається в процесі ампліфікації, зменшення кількості маніпуляцій на стадії секвенування, а також підвищення точності і достовірності діагностики шляхом зниження ймовірності помилок при визначенні послідовності екзонів гена DES.

Зменшення витраченого часу досягається в результаті проведення ампліфікації всіх екзонів гена DES одночасно при одній і Ѿвательностями Seq ID NO:1-14.

Додатково, зменшення кількості маніпуляцій і внаслідок цього додаткове зменшення витраченого часу та зниження вірогідності помилок досягається в результаті подальшого секвенування отриманих продуктів ампліфікації з використанням однієї пари універсальних праймерів за рахунок приєднання до послідовності Seq ID NO:1-14 з 5'-кінця послідовності одного із згаданої пари універсальних праймерів.

Зокрема, в якості таких універсальних праймерів можуть бути використані прямий праймер pUC/M13(-21) Seq ID NO:15 і зворотний праймер М13(-29) Seq ID NO:16.

У цьому винаході пропонується набір праймерів для визначення послідовності екзонів гена DES, з використанням якого ампліфікацію всіх екзонів можна проводити одночасно при одній температурі та часу відпалу праймерів, а подальше секвенування продуктів ампліфікації можна проводити з використанням однієї пари універсальних праймерів.

Створення специфічних праймерів для ампліфікації

Вибір специфічних праймерів для ампліфікації цікавить фрагмента ДНК здійснюють способом, добре відомим фахівцям в даній області. Робота над створенням праймерів будується зви�цільове геномі вибирають унікальний ділянку, містить область інтересу дослідника.

2) На підставі обраного ділянки геному за допомогою спеціального програмного забезпечення підбирають послідовність олігонуклеотидів, що використовуються для проведення ПНР, як правило, 2 праймера. Багато з таких програм перебувають у вільному доступі, наприклад, Primer3 (http://frodo.wi.mit.edu/), Primer designing tool (NCBI), PerlPrimer (http://perlprimer.sourceforge.net/).

3) Пари праймерів додатково перевіряють на поліморфізми цільової послідовності в області комплементарної 3'-кінцевого ділянки праймера.

4) До послідовності прямих праймерів з 5'-кінця приєднують послідовність одного з універсальних праймерів, а до послідовності зворотних праймерів з 5'-кінця приєднують послідовність іншого універсального праймера, відмінну від тієї, яка приєднана до прямих праймерами.

4) Праймери синтезують на замовлення в спеціалізованому сервісному центрі, наприклад НВК Синтол.

5) З допомогою практичних експериментів доводять придатність підібраних послідовності праймерів для конкретних цілей.

Вибір праймерів, що є предметом цього винаходу, характеризується тим, що праймери підбирали таким чином, щоб оптималь�ймеров для ампліфікації екзонів гена DES характеризується тим, що містить

1) праймери наступного нуклеотидного складу:

Екзон гена DESПраймерПослідовністьНомер послідовності
1F1Des1f1GCTGATGTCAGGAGGGATACSeq ID NO:1
1R1Des1r1GGTCATTGATCGTTGGTGCGSeq ID NO:2
1F2Des1f2ACGCCCTCCTCCTACGGCGCSeq ID NO:3
1R2Des1f2GAAGGCAGGAGGTGACAGCGSeq ID NO:4
2-3FDes2-3fCTGCCTCTACCCAGCACCASeq ID NO:5
2-3RDes2-3rATTCCCAGCCAGAGCCTCASeq ID NO:6
4-5FDes4-5fDes4-5rAGTGAGGGTGTGAACTGCAGACAGSeq ID NO:8
6FDes6fGCCTGCCAGCCCAAAGCTTTCTTTGSeq ID NO:9
6RDes6rTGAGGTAATCAGTAATCTCGAGCCTCCSeq ID NO:10
7FDes7fGGCCGATGGGAGGGTTCTTASeq ID NO:11
7RDes7rAGTGCCCATGCTGGACTCCTSeq ID NO:12
8-9FDes8-9fGAAGAAGTAACAAGCCTGTCTSeq ID NO:13
8-9RDes8-9rTGTGATTTGGAGGACTGAGGCSeq ID NO:14

2) додатково до послідовності праймерів Seq ID NO:1, Seq ID NO:3, Seq ID NO:5, Seq ID NO:7, Seq ID NO:9, Seq ID NO:11, Seq ID NO:13, званих «прямими праймерами», з 5'-кінця приєднана послідовність одного універсального праймера, наприклад прямого праймера pUC/M13(-21) Seq ID NO: 15, а до постеж», з 5'-кінця приєднана послідовність іншого універсального праймера, наприклад зворотного праймера М13(-29) Seq ID NO: 16.

Крім пропонованих праймерів, у реакційну суміш для ампліфікації входять наступні компоненти:

- суміш дезоксирибонуклеотидтрифосфатов чотирьох типів (dATP, dTTP, dGTP, dCTP);

- фермент Taq-полімераза;

- реакційний буфер: 100 ммоль Tris-HCl, рН 8,8 при 25°С, 500 ммоль KCl, 20 ммоль MgCl2.

Ампліфікація екзонів гена DES

Кодує частина гена DES довжиною 2268 пар нуклеотидів складається з 9 фрагментів, або екзонів. У разі невеликих екзонів пропонований набір праймерів дозволяє амплифицировать 2 цілих екзона з перебувають між фрагментами некодирующим ділянкою гена, або інтроном. У разі великих екзонів, наприклад екзона 1, ампліфікацію проводять у вигляді двох накладання фрагментів. Ампліфікацію проводять з розрахунку 7 реакцій на один зразок геномної ДНК за наступною схемою:

Номер
реакційної
суміші
Номер екзонаВикористовувані пари праймерів
11Des1f1, Des1r132-3Des2-3f, Des2-3r
44-5Des4-5f, Des4-5r
56Des6f, Des6r
67Des7f, Des7r
78-9Des8-9f, Des8-9r

Реакцію ампліфікації проводять одночасно для всіх реакційних сумішей з використанням спеціалізованого устаткування - ампліфікатора Veriti® Thermal Cycler, Applied Biosystems, США згідно наступного температурного режиму:

ТемператураЧасКількість циклів
195°С5 хв1
295°С4530
330
572°С11 хв1

Секренирование екзонів гена DES

Після закінчення реакції ампліфікації отримані на першому етапі аналізу продукти ампліфікації використовують для постановки реакції секвенування. В реакції секвенування продуктів ампліфікації, отриманих в результаті першого етапу аналізу, використовують універсальні праймери, наприклад прямий праймер pUC/M13(-21) Seq ID NO: 15 і зворотний праймер М13(-29) Seq ID NO:16. При цьому праймери змішують з реакційним буфером перед роботою, і таким чином виключають стадію внесення різних праймерів в лунки микропланшета, в яких буде проходити реакція секвенування, це істотно знижує ризик допустити помилку під час внесення компонентів та зменшує час внесення реактивів більш ніж в два рази.

Реакцію секвенування проводять із застосуванням набору мічених дидезоксирибонуклеотидтрифосфатов (BigDye Terminator Cycle Sequencing Kit, версія 3.0, Applied Biosystems, США) і спеціалізованого устаткування - ампліфікатора Veriti® Thermal Cycler, Applied Biosystems, США, згідно наступного температурного режиму:

Кількість циклів
195°С5 хв1
295°С4530
360°С30
472°С30
572°С11 хв1

Электрофоретический аналіз продуктів секвенування виробляють на секвенаторе ABI PRISM 377, Applied Biosystems, США. Обробку отриманих даних роблять за допомогою програми BioEdit або іншого аналогічного програмного забезпечення.

Винахід ілюструється наступним графічним матеріалом.

На фіг.1 представлено графічне зображення результатів секвенування, отриманих при використанні заявляються праймерів для ампліфікації та визначення нуклеотидної послідовності 2 екзона гена DES. Виявлена IVS3+1G→А мутація гена DES.

Заявляється набір праймерів застосовують следующимогут бути використані біоптати тканин, кров, зіскрібки букального епітелію.

2) Виділення та очищення препаратів ДНК з вихідних зразків. Способи виділення ДНК з біологічного матеріалу добре відомі фахівцям і, як правило, включають стадії лізису клітин, виділення ДНК та її очищення. Швидке та якісне виділення ДНК можна проводити з використанням комерційно доступних наборів реагентів, наприклад «Flexi Gene DNA kit» (не є предметом даного патенту).

3) Ампліфікація отриманих препаратів геномної ДНК з застосуванням запропонованого набору праймерів, специфічних до экзонам гена DES, 7 реакцій при однакових умовах, 1 завантаження ампліфікатора. Електрофоретичне розділення і подальша очистка продуктів ампліфікації.

4) Секвенування продуктів ампліфікації, отриманих у п. 3 із застосуванням пари комерційно доступних універсальних праймерів, 7 реакцій. Очищення продуктів реакції секвенування і подальший капілярний електрофорез.

5) Аналіз результатів реакції секвенування з використанням спеціалізованого програмного забезпечення, наприклад BioEdit.

GCTGATGTCAGGAGGGATACSeq ID NO:1GGTCATTGATCGTTGGTGCGSeq ID NO:2ACGCCCTCCTCCTACGGCGCSeq ID NO:3GAAGGCAGGAGGTGACAGCGSeq ID NO:4CTGCCTCTACCCAGCAGCCASeq ID NO:5ATTCCCAGCCAGAGCCTCASeq ID NO:6AAGCCCAGTCATGCCCTACAGSeq ID NO:7AGTGAGGGTGTGAACTGCAGACAGSeq ID NO:8GCCTGCCAGCCCAAAGCTTTCTTTGSeq ID NO:9TGAGGTAATCAGTAATCTCGAGCCTCCSeq ID NO:10GGCCGATGGGAGGGTTCTTASeq ID NO:11AGTGCCCATGCTGGACTCCTSeq ID NO:12GAAGAAGTAACAAGCCTGTCTSeq ID NO:13TGTGATTTGGAGGACTGAGGC3. Набір синтетичних нуклеотидів за п. 2, в якому в якості одного з першого або другого універсальних праймерів використовують прямий праймер pUC/M13(-21) Seq ID NO:15, а в якості іншого універсального праймера використовують зворотний праймер М13(-29) Seq ID NO:16.



 

Схожі патенти:

Інгібування axl сигналізації в антиметастатической терапії

Винахід відноситься до галузі біотехнології, конкретно до інгібіторів сигнального шляху AXL, і може бути використане в медицині. Отримують розчинну варіант поліпептиду AXL без трансмембранного домену AXL, який містить щонайменше одну модифікацію амінокислоти в положенні номер n, де n обраний 32, 72, 87, 92 або 127 або їх поєднання, де n+7 відповідає нумерації SEQ ID NO: 1 - послідовності AXL дикого типу, в якому зазначена модифікація підвищує спорідненість зв'язування поліпептиду AXL зі специфічно затримує зростання білком 6 (GAS6), яке, по меншою мірою, приблизно в 2 рази сильніше, ніж спорідненість поліпептиду AXL дикого типу. Поліпептид може бути злитий з Fc фрагментом і використаний в способі лікування, зниження або запобігання метастазування або інвазії пухлини у пацієнта-ссавця. Винахід дозволяє ефективно інгібувати сигнальні шляхи AXL/GAS6. 6 н. і 2 з.п. ф-ли, 15 іл., 6 табл., 3 пр.

Набір олігонуклеотидних праймерів і флуоресцентно-міченого зонда для ідентифікації burkholderia pseudomallei

Винахід відноситься до галузі біохімії, зокрема до набору олігонуклеотидних праймерів і флуоресцентно-міченого зонда для ідентифікації Burkholderia pseudomallei і диференціації від збудника сапу методом полімеразної ланцюгової реакції з флуоресцентною детекцією. Заявлений винахід дозволяє в короткий термін з високою чутливістю і специфічністю детектувати збудника меліоїдоза і диференціювати його від збудника сапу в пробах чистих культур та біологічному матеріалі. 1 іл., 1 табл., 3 пр.

Спосіб визначення генотипу людини з поліморфною позиції rs1613662 в гені gp6, кодує глікопротеїн vi

Винахід відноситься до галузі медицини, молекулярної біології та біотехнології. Запропоновано спосіб визначення поліморфізму гена GP6 людини, що кодує глікопротеїн VI, з поліморфною позиції rs 1613662, заснований на зняття кривих плавлення з флуоресцентно-міченими алель-специфічними олигонуклеотидними пробами. Завдяки збільшенню надійності визначення варіабельних позицій і можливості проводити визначення в одній пробірці на стандартному обладнанні спосіб може бути ефективно використаний для діагностики спадкових схильностей людини з реєстрацією результатів ПЛР в реальному часі. 1 іл.

Пептиди, які проникають у клітини, і їх застосування

Винахід відноситься до галузі біотехнології, конкретно до інтерналізації терапевтичних молекул всередину клітини, і може бути використане в медицині. Отримують композицію для доставки молекул нуклеїнових кислот в клітини, що містить щонайменше один пептид з щонайменше 92% ідентичністю до GAAEAAARVYDLGLRRLRQRRRLRRERVRA (SEQ ID NO: 2); IREIMEKFGKQPVSLPARRLKLRGRKRRQR (SEQ ID NO: 3); або YLKVVRKHHRVIAGQFFGHHHTDSFRMLYD (SEQ ID NO: 4), приєднаний до однієї або кількох молекул нуклеїнових кислот. Винахід дозволяє підвищити ефективність доставки молекул нуклеїнових кислот всередину клітини ссавця за рахунок пептиду, здатного интернализироваться всередину клітини ссавця з ефективністю, що становить щонайменше 200% від ефективності інтерналізації пептиду ТАТ, має аминокислотную послідовність GRKKRRQRRRPPQ (SEQ ID NO: 1). 5 н. і 3 з.п. ф-ли, 16 іл., 1 табл., 8 пр.

Спосіб аналізу рнк

Винахід відноситься до біотехнології, а саме до способу аналізу придатності РНК, екстрагованої з тканини або клітини (клітин), фіксованих за допомогою фіксатора, для аналізу експресії генів. Спосіб включає проведення електрофорезу з зазначеної РНК. Визначають, чи відповідає зазначена РНК наступному рівнянню: В/А≤1, де А являє масове співвідношення (%) РНК в діапазоні від 1000 до 4000 нуклеотидів до загальної маси РНК, що визначено електрофорезом, а являє масове співвідношення (%) РНК в діапазоні більш ніж 4000 нуклеотидів до загальної маси РНК, що визначено електрофорезом. Якщо зазначена РНК, экстрагированная з тканини або клітини (клітин), що задовольняє вказаним рівнянню, то вона придатна для аналізу експресії генів. Запропоноване винахід дозволяє швидко і з високою ефективністю визначити придатність РНК для аналізу експресії генів. 6 з.п. ф-ли, 3 іл., 11 табл., 7 пр.

Виборчий лізис клітин

Група винаходів відноситься до області лізису клітин. Запропоновано спосіб виборчого лізису клітин тварин, а також прилад для виявлення мікроорганізмів. Спосіб виборчого лізису тварин клітин в пробі води з тваринами клітинами, що містить або, можливо, містить мікроорганізми, включає етапи забезпечення проби води з тваринами клітинами, що містить або, можливо, містить мікроорганізми, додавання в згадану пробу неіоногенної детергенту і буферного розчину для одержання розчину зі значенням pH близько 9,5 або вище, інкубації цього розчину протягом періоду, достатнього для лізису клітин тварин. Прилад для виявлення мікроорганізмів у пробі складається з лизисной камери для прийняття проби води з тваринами клітинами, посудини з лужним буферним розчином із значенням pH 9,5 або вище і неіоногенним детергентом, або посудини з лужним буферним розчином із значенням pH близько 9,5 або більше і посудини з неіоногенним детергентом, фільтра, сполученого з лизисной камерою для фільтрування проби після лізису клітин тварин, камери індикації для аналізу присутності ДНК мікроорганізмів. Запропоновані винаходу забезпечують обробку зразка без його значного брабативать більш значні обсяги зразка і визначати низькі концентрації хвороботворних мікроорганізмів у зразку. 2 н. і 11 з.п. ф-ли, 12 іл., 8 пр.

Спосіб диференціації токсигенних генетично змінених штамів vibrio cholerae біовару ель-тор з різним епідемічним потенціалом методом мультиплексного полімеразної ланцюгової реакції та тест-система для його здійснення

Винаходи належать до галузі медичної мікробіології і стосуються способу диференціації токсигенних генетично змінених штамів V. cholerae біовару Ель-Тор і тест-системи. Охарактеризований спосіб включає проведення ПЛР з використанням специфічних праймерів до генам vc0497, vc0502 і vc0514 з острова пандемичности VSP-II. Охарактеризована тест-система містить компоненти для виділення ДНК, компоненти для проведення ПЛР, що включають, зокрема, суміш праймерів VSPIIreg-F - 5'-TGGAAAGAAGAGCGTTACTGC-3', VSPIIreg-R - 5'-CCCTGTTGATGATGTGATTTG-3' ген vc0497, VSPIIpilin-F - 5'-CTGTGATTCGGGCTTTATCGG-3', VSPIIpilin-R - 5'-GCGTAAACTGAGCCAATAAGC-3' ген vc0502, VSPIIchem-F - 5'-CTTGATGGAGCGGAGAAAAC-3', VSPIIchem-R - 5'-CGATGAATAGCCTGTTGAAC-3' ген vc0514, взятих у співвідношенні 1:1:1:1:1:1 відповідно. Винаходи дозволяють швидко і достовірно диференціювати токсигенні генетично змінені штами V. cholerae біовару Ель-Тор на геноварианти з низьким і високим епідемічним потенціалом. 2 н. п. ф-ли, 1 іл., 2 табл.

Спосіб виявлення мутацій в гені myo7a, що супроводжуються розвитком несиндромальной аутосомно-рецесивною глухоти і синдромом ушера

Винахід відноситься до галузі біохімії, зокрема до способу виявлення мутацій в гені MYO7A, що супроводжуються розвитком несиндромальной аутосомно-рецесивною глухоти або синдром Ушера. Спосіб включає виділення ДНК з лімфоцитів периферичної крові методом фенольно-хлороформною екстракції, проведення ПЛР, ампліфікацію 18 ділянок гена MYO7A, детекцію в денатурирующем акриламидном гелі і секвенування. ПЛР проводять з використанням спеціально підібраних послідовностей олігонуклеотидів, фланкують області 18 екзонів гена MYO7A з можливим вмістом різних мутацій. Винахід дозволяє спростити спосіб і підвищити точність визначення мутацій гена MYO7A, а також скоротити час дослідження. 3 іл., 1 пр.
Винахід відноситься до галузі біотехнології і стосується специфічних олігонуклеотидних праймерів. Представлені праймери включають сайти эндонуклеазного розщеплення, фланкуючі ділянки геному, що кодують глікопротеїни Gn і Gc, а також нуклеопротеин N, для отримання бібліотеки генів, що кодують глікопротеїни Gn і Gc і нуклеопротеин N вірусу лихоманки долини Ріфт. Охарактеризованное винахід може бути використаний у створенні банку нуклеотидних послідовностей, що кодують імунодомінантні білки вірусу лихоманки долини Ріфт Gn, Gc і N, які можна використовувати при створенні діагностичних і вакцинних препаратів на основі рекомбінантних технологій. 3пр.

Олігонуклеотидні праймери і спосіб виявлення днк mycobacterium avium методом полімеразної ланцюгової реакції

Винаходи належать до галузі біотехнології і стосуються олігонуклеотидних праймерів і способи виявлення ДНК Mycobacterium avium з їх використанням. Охарактеризовані олігонуклеотидні праймери комплементарни специфічної області mig-гена Mycobacterium avium і мають наступний нуклеотидний склад: 5'-CGT CAA AAG CGA ACT GCA-3' та 5'-ТАА ТТС GTT GCC CGA СТС-3'. Спосіб виявлення ДНК Mycobacterium avium вимикає виділення ДНК, проведення ампліфікації ДНК з використанням олігонуклеотидних праймерів, перенесення продукту ампліфікації на гель з подальшим детектуванням результатів аналізу на трансиллюминаторе. У разі позитивної реакції синтезується фрагмент, відповідний розміру 157 п. н. Представлені винаходи можуть використовуватися у ветеринарних діагностичних і науково-практичних лабораторіях для виявлення генетичного матеріалу Mycobacterium avium у пробах. 2 н. п. ф-ли, 1 іл., 4 пр.

Конкатемери для імуномодуляції

Винахід відноситься до галузі біохімії. Запропоновано конкатемерная молекула некодирующей нуклеїнової кислоти, що містить щонайменше чотири одноланцюгових ділянки з неметилированними CG-мотивами, для модуляції активності імунної системи людини і тварини. Розглянуто містять конкатемерную молекулу фармацевтичні композиції та набір, а також застосування для виготовлення засобу для модуляції імунної системи або для модуляції активності імунної системи людини або тварини молекули та композиції з винаходу. Цей винахід може знайти подальше застосування в якості імуномодулятора в терапії різних захворювань. 5 н. і 15 з.п. ф-ли, 4 іл.

Спосіб виявлення стійких до пиразинамину ізолятів mycobacterium tuberculosis

Винахід відноситься до галузі біохімії, зокрема до способу виявлення стійких до пиразииамиду ізолятів Mycobacterium tuberculosis, шляхом визначення наявності мутацій в гені pncA, асоційованих з формуванням стійкості до пиразинамиду, за допомогою проведення ПЛР в режимі «реального часу» з використанням HRM-аналізу. При цьому проводять ампліфікацію на суміші рівної кількості досліджуваної ДНК і ДНК дикого типу з використанням праймерів: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' і Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', формують гетеродуплекси за рахунок одночасної коамплификации ДНК дикого типу і досліджуваної ДНК, при цьому на першому етапі ПЛР проводять вирівнювання концентрації за допомогою кількісної ПЛР з використанням пари праймерів (Pnc18U/Pnc15R) з побудовою калібрувальної кривої і використанням регресійного рівняння. Винахід завдяки високій специфічності і чутливості дозволяє надійно і швидко визначити тип мутацій в гені pncA, асоційованих з виникненням стійкості до пиразинамиду.1 іл.

Олігопептиди imp-3 і утримують їх вакцини

Винахід відноситься до олигопептидам, що містить послідовність NLSSAEVVV (SEQ ID NO:6), в якій одна або дві амінокислоти можуть бути заміщені, мають индуцибельность цитотоксичних Т-клітин, їх фармацевтичним композиціям і застосування для виготовлення протиракових вакцин. 10 н. і 10 з.п. ф-ли, 6 іл., 1 табл., 1 пр.

Самоиндуцируемая экспрессионная система та її застосування для отримання корисних метаболітів з допомогою бактерії родини enterobacteriaceae

Винахід відноситься до біотехнології і надає собою спосіб отримання корисних метаболітів з використанням бактерії родини Enterobacteriaceae, зокрема бактерії, що належить до роду Escherichia, яка модифікована таким чином, що вона містить генетичну експресійної систему, що включає транскрипційний апарат, регульований білком типу LysR, і модифікована таким чином, що самоиндуцируемая позитивна регуляція за типом зворотного зв'язку зазначеної системи опосередкована коиндуктором. Цей спосіб придатний для продукції L-амінокислот з розгалуженою ланцюгом, зокрема L-валіну, L-ізолейцин і L-лейцину, вищих спиртів і D-пантотенової кислоти. Винахід дозволяє отримувати L-амінокислоти з високим ступенем ефективності. 3 н. і 20 з.п. ф-ли, 2 іл., 5 табл., 6 пр.

Рнк-аптамери, що володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла

Винахід відноситься до галузі біотехнології та медицини і стосується РНК-аптамери. Запропонований РНК-аптамери являє собою 57-звенний олигонуклеотид змішаного типу, що має нуклеотидну послідовність GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, де A,G - рибонуклеотиди, U, С - 2'-дезокси-2'-фторрибонуклеотиди, володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла. Охарактеризованное винахід специфічно і високоафинно зв'язується з аутоантителами, характерними для розсіяного склерозу і може бути використане для діагностики розсіяного склерозу. 3 іл., 2 пр.

Спосіб визначення генотипу людини за поліморфізму в гені матриксною металопротеїнази ммр9-1562 з>т (rs3918242)

Винахід відноситься до галузі біотехнології і може бути використане для визначення генотипу людини за поліморфізму в гені матриксною металопротеїнази ММР9-1562 C>Т (rs3918242). Спосіб заснований на зняття кривих плавлення з флуоресцентно-міченими алель-специфічними олигонуклеотидними пробами. У способі використовують загальну для всіх алелів пару праймерів, що відрізняються для кожного алелю флуоресцентно-мічені алель-специфічні олігонуклеотидні проби і універсальний олигонуклеотид, мічений гасителем флуоресценції наступного нуклеотидного складу: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), де FAM - означає флуоресцентний барвник FAM, HEX - означає флуоресцентний барвник HEX, BHQ1 - означає приєднаний до 5'-кінцевого нуклеотиду темнової гаситель флуоресценції. Віднесення зразка до гомозиготе або гетерозиготе за даним аллелю оцінюється за формою кривих плавлення ДНК - по максимуму першої похідної графіків флуоресценції. Винахід дозволяє підвищити надійність і доступність генотипування. 1 іл.

Спосіб одночасної ампліфікації і флуоресцентного маркування кількох сегментів геному мікобактерій туберкульозного комплексу

Винахід відноситься до біохімії. Винахід забезпечує спосіб одночасної (мультиплексного) ампліфікації і флуоресцентного маркування ДНК декількох сегментів геному мікобактерій туберкульозного комплексу (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum M. microti). Далі проводиться гибридизационний або электрофоретический аналіз послідовностей даних сегментів. Мультиплексна ПЛР здійснюється в єдиному реакційному обсязі з використанням специфічних і адаптерних праймерів, флуоресцентного субстрату, вбудованого в зростаючу ланцюг ДНК в ході ПЛР і геномної ДНК в якості матриці. Мультиплексна ПЛР включає два послідовних профілю ампліфікації, що розрізняються температурами відпалу специфічних і адаптерних праймерів не менш ніж на 10°С. Винахід дозволяє проводити аналіз послідовностей даних генів на виявлення мутацій, асоційованих з стійкістю до протитуберкульозних препаратів. Спосіб за винаходом скорочує число стадій амплификаций для отримання одноланцюгових флуресцентно-мічених ПЛР-продуктів, виключає перенесення ДНК-матриці з одного реакційного об'єму в іншій, що підвищує стійкість до процедури контамінації ПЛР-продуктами і істот

Спосіб отримання иммуногенной композиції на основі гібридного білка cfp10-dbd і декстрану, рекомбінантна плазміда pcfp10-dbd, штам escherichia coli [prep4, pcfp10-dbd], химерний білок cfp10-dbd та їх застосування

Група винаходів відноситься до генної інженерії, біохімії, біотехнології та імунології. Представлена рекомбінантна плазміда pCFP10-DBD, що складається з штучного бактеріального оперона химерного білка, що включає промоторную область раннього промотору бактеріофага Т5, ген химерного білка, що складається з послідовності білкового антигену CFP10 з Mycobacterium tuberculosis, злитої з послідовністю декстрансвязивающего домену (DBD) декстрансукрази Leuconostoc citreum KM20, і термінатор транскрипції, бактеріального оперона бета-лактамази і бактеріального ділянки ініціації реплікації типу ColE1. Також представлений штам Escherichia coli - продуцента химерного білка CFP10-DBD. Описаний спосіб іммобілізації, концентрування та очищення отриманого білка на целюлозі. Описана иммуногенная композиція, що містить рекомбінантний білок CFP10-DBD, спрямована на індукцію імунітету проти туберкульозної інфекції. Винахід розширює арсенал засобів, які використовуються для лікування туберкульозу. 4 н. п. ф-ли, 6 іл., 1 табл., 4 пр.

Пристрій для автоматичного очищення біологічних зразків, оснащене елементом для прикладання магнітного поля, спосіб вилучення цільового речовини з біологічного зразка і спосіб експресії і очищення білка

Заявлена група винаходів відноситься до галузі біології, зокрема до устаткування для автоматичного очищення біологічних зразків при виділенні цільових речовин з безлічі біологічних зразків, для автоматичного очищення біологічного зразка, оснащене елементом для прикладання магнітного поля, в якому елемент для прикладання магнітного поля для очищення біологічних зразків і нагрівальний елемент сформовані у вигляді єдиного компонента один з одним так, щоб бути рухливими вгору і вниз. Пристрій для автоматичного очищення містить блок 100 піпеток, який розміщений з можливістю вертикального і горизонтального переміщення, у який з можливістю видалення встановлено безліч піпеток 141, 142 для всмоктування та виведення матеріалу текучого середовища, нагрівальний елемент 810 для нагрівання конкретного блоку лунок многолуночного планшета 420, 420', елемент 700 для прикладання магнітного поля, встановлений на опорній плиті 400, містить елемент 710 для установки магніту. На елементі 700 змонтований магніт 711, розміщений у нижній сторони конкретного блоку лунок многолуночного планшета 420, 420', і підйомний елемент 760 для підйому вгору і опускання вниз елемента 710 длѽшета 420, 420', розміщеним в нижній боку блоку 100 піпеток, і видаляти від нього. В способі витягу цільового речовини з біологічного зразка використано пристрій для автоматичного очищення біологічного зразка, оснащене елементом програми магнітного поля. Винаходи забезпечують підвищення ефективності і якості виділення та очищення. 6 н. і 20 з.п. ф-ли, 48 іл.

Бионаноконъюгат для виявлення і виділення нуклеїнових кислот та спосіб його одержання

Винахід відноситься до галузі біотехнології, конкретно до створення кон'югатів магнітна частка - нуклеїнова кислота, і може бути використане для молекулярно-генетичної діагностики. Бионаноконъюгат включає нанорозмірну суперпарамагнитную частку кобальтової феррошпинели CoxFe3-xO4, де 0.6≤x≤0.98, отриману механохимическим синтезом. Для виділення нуклеїнової кислоти, що містить оліго - або полі-A/dA послідовність, використовують синтетичний одноцепочечний олигонуклеотид 5'-dGndTm, де n=5-30, m=10-35, один ділянка якого складається з гуанинових нуклеотидів, у присутності фосфат-аніонів у розчині специфічно пов'язаний з поверхнею наночастинки, а інший - складається з тиминових нуклеотидів, здатний вступати в гібридизацію з оліго - або полі-A/dA нуклеотидними послідовностями. Для виділення з розчину в присутності фосфат-аніонів специфічної гетеронуклеотидной послідовності додатково використовують молекулу олигонуклеотида-адаптера, що містить послідовність оліго-dAx на 3'-кінці, гибридизованную з тиминовими нуклеотидами комплексу комплексу 5'-dGndTm, де n=5-30, m=10-35, і ділянка на 5'-кінці, комплементарний специфічної гетеронуклеотидной послідовності �. � 1 з.п. ф-ли, 8 іл., 1 табл., 5 пр.

Конкатемери для імуномодуляції

Винахід відноситься до галузі біохімії. Запропоновано конкатемерная молекула некодирующей нуклеїнової кислоти, що містить щонайменше чотири одноланцюгових ділянки з неметилированними CG-мотивами, для модуляції активності імунної системи людини і тварини. Розглянуто містять конкатемерную молекулу фармацевтичні композиції та набір, а також застосування для виготовлення засобу для модуляції імунної системи або для модуляції активності імунної системи людини або тварини молекули та композиції з винаходу. Цей винахід може знайти подальше застосування в якості імуномодулятора в терапії різних захворювань. 5 н. і 15 з.п. ф-ли, 4 іл.
Up!