Спосіб індукції апоптозу клітин злоякісної пухлини колоректального раку та засіб для його здійснення

 

Заявлювана група винаходів відноситься до галузі медицини, зокрема, до терапії онкологічних захворювань. Терапія займає важливе місце в лікуванні, наприклад, колоректального раку, і одним з основних засобів її є хіміотерапія. Застосовувані в даний час кошти хіміотерапії характеризуються не високою ефективністю, але вельми значущою токсичністю, що обмежує можливості тривалого впливу на пухлину. Найбільш сучасним засобом в даний час є так звана таргетна терапія, спрямована на блокування прояви конкретних генів. Препарати таргетної терапії (від англійського слова target - мета, мішень) - створений відносно недавно клас протипухлинних ліків, які мають здатність вибірково впливати на патогенетичні молекулярні мішені. Відомі способи і засоби таргетної терапії для блокування окремих генів також недосконалі. Застосування існуючих комерційних таргетних препаратів у якості монотерапії далеко не завжди дає істотний ефект. Це призвело до включення таких препаратів до складу комплексної терапії, що поєднує стандартні хіміотерапевтичні впливу з применеЕится мала специфічність, що призводить до суттєвих неспецифічних ефектів, що обумовлює токсичність. У своїй більшості такі препарати є антитілами до білків, кодируемим генами. Такі антитіла є чужорідними для організму речовинами, мають неповну специфічність і володіють великими розмірами, що ускладнюють їх доставку до білка-мішені. Зазначені властивості призводять до значних побічних ефектів і недостатньої ефективності наявних таргетних препаратів. На противагу цьому, мірнк - природні речовини, що функціонують у клітинах людини та інших ссавців). Штучно введені мірнк не будуть чужорідними для організму речовинами. Як природні, так і синтезовані мірнк, володіють абсолютною специфічністю, що дозволяє впливати саме на ті гени, функція яких повинна бути ингибирована. Вони мають малі розміри, що полегшують їх ефективну доставку в ракову клітку. Крім того, мірнк переривають процес функціонального прояву генів на більш ранній стадії, до синтезу білків, кількість яких значно більше, ніж матричної РНК. Внаслідок цього потрібні менші кількості що вводяться в організм хворого речовин.

Таргетні препарати, розроблені і з цим, актуальним розвиток нових таргетних препаратів і пошук альтернативних лікувальних підходів. Одним з таких підходів є виявлення генів, інгібування яких здатне приводити не тільки до зниження життєздатності ракової клітини, а й до посилення чутливості пухлини до стандартного лікування хіміотерапією. Даний винахід базується на нових підходах, які базуються на останніх досягненнях «постгеномній ери».

Відомий спосіб модулювання функції та/або експресії гена-супресора пухлин в клітинах чи тканинах ссавців in vivo або in vitro, включає контактування зазначених клітин або тканин з принаймні одним олигонуклеотидом короткої інтерферує РНК (мірнк) довжиною від 5 до 30 нуклеотидів, що є специфічною щодо антисмислового полинуклеотида гена-супресора пухлин. Ген-супресор пухлин (антионкоген, пухлинний супресор) - ген, продукт якого забезпечує профілактику пухлинної трансформації клітин. Білкові продукти генів-супресорів називають білками-супрессорами або антионкобелками. Крім того, антионкогени можуть кодувати і микроРНК (UA №2011127196).

Відомий багатопрофільний промотор, що забезпечує всередині ракових кл�сичное з'єднання - проліки в токсин, що містить змінену або розширений, у порівнянні з відомими промоторами, сукупність ділянок впізнавання білків-факторів транскрипції, необхідний набір яких існує в більшості ракових, але не в нормальних клітинах, і представляє тандемну комбінацію BIRC5 і TERT промоторів або похідне тандемною комбінації BIRC5 і TERT промоторів, утворена в результаті поділу, заміни, інсерції або іншої мутації промотору, не впливають на активність промотору, але при цьому змінюють його структуру. Экспрессирующий вектор містить багатофункціональний промотор, з'єднаний з транскрибируемой послідовністю, яка при транскрипції продукує інформаційну РНК, що кодує фермент, що перетворює нетоксична - проліки у внутрішньоклітинний токсин. Экспрессирующий вектор являє собою вірусний вектор або невирусний вектор. Там же відомий спосіб виборчого вбивства ракових, але не нормальних клітин, що приводить до синтезу токсинів всередині ракових клітин, що включає доставку в пухлину генної конструкції, що складається з гена ферменту, здатного перетворювати усередині ракової клітини нетоксическое з'єднання - проліки в токсин, і багатопрофільного �ать усередині ракової клітини нетоксичний з'єднання - проліки в токсин, і блокованого промотору, при деблокировании забезпечує експресію цього гена, а друга є деблокирующей конструкцією, яка містить багатопрофільний промотор, приєднаний до гену деблокатора, що кодує білок деблокатор, здатний виконати неактивний блокований промотор, при цьому синтезується усередині ракової клітини токсин дифундує в навколишні ракові клітини (UA №2476596).

Відомий спосіб індукції апоптозу в клітині-мішені, і засіб, в якому виділена двухцепочечная молекула РНК, яка, по суті, відповідає частині нуклеотидної послідовності мишеневой нуклеїнової кислоти, де кожна ланцюг РНК має довжину 23 нуклеотиду і, щонайменше, одна ланцюг має 3' - виступ з 1-5 нуклеотидів, причому зазначена молекула РНК здатна до мішень-специфічної РНК-інтерференції. (UA №2470073).

Відома фармацевтична композиція, що містить дезінтегратор мітозу/інгібітор біохімічного шляху polo-подібної кінази (Plk), зокрема ON01910, ON01910-Na або мірнк, спрямовану на Plk1, і хіміотерапевтичний агент, що представляє собою нуклеотидний аналог, в ефективному кількості, а також фармацевтично і фізіологічно прийнятний носій, дл�евтическому агенту, представляє собою нуклеотидний аналог, у суб'єкта, який страждає на рак, або для використання в якості лікарського засобу для лікування раку, резистентного до хіміотерапевтичне агенту, який представляє собою нуклеотидний аналог, нужденного в цьому пацієнта. Хіміотерапевтичний агент являє собою нуклеотидний аналог, обраний із групи, що складається з кладрибина, клофарабина, флударабина, меркаптопурину, пентостатина, тиогуанина, капецитабіну, цитарабіну, децитабина, фторурацилу, флоксуридина, сапацитабина і гемцитабина; або хіміотерапевтичний агент являє собою нуклеотидний аналог, являє собою гемцитабін (UA №2476239, прототип).

Недоліками відомих способів та засобів індукції апоптозу клітин злоякісної пухлини є недостатня ефективність, велика тривалість лікування до отримання значущих результатів, висока ймовірність побічних явищ, характерних для хіміотерапії, зумовлені тим, що в прототипі забезпечують і оцінюють зниження числа клітин, що може бути пов'язано зі зниженням проліферації, тобто, швидкості розмноження ракових клітин. Для цього, блокуючи ген, що збільшують чутливість до хіміотерапії при її станрешается. Апоптотическая загибель вже утворених клітин пухлини застосовуваними засобами не забезпечується достатньою для лікування мірою і не визначається. Використання для інгібування гена малих молекул може мати недостатню специфічність, що призведе до суттєвих неспецифічних ефектів, що обумовлює додаткову токсичність.

Технічною задачею групи винаходів є створення ефективних способу і засобу індукції апоптозу клітин злоякісної пухлини, а також розширення арсеналу способів і засобів індукції апоптозу клітин злоякісної пухлини.

Технічний результат, що забезпечує вирішення поставленого завдання полягає в підвищенні ефективності, тобто, оптимізації та активізації впливу платиносодержащего лікарського засобу на клітини пухлини колоректального раку за рахунок того, що блокуванням відповідних генів забезпечується істотна апоптотическая загибель ракових клітин при дозі лікарського засобу, принципово нижче стандартної. Таким чином, досягається зниження токсичності при збереженні або підвищенні ефективності терапії. Це досягається завдяки одночасному впливу на конкретні антиапевих інтерферуючих РНК (мірнк, siRNA - small interfering RNA), що тягне за собою скорочення тривалості лікування до отримання значущих результатів, при зниженні ймовірності побічних явищ.

До числа широко використовуваних хіміопрепаратів відносяться похідні платини, такі як цисплатин (цис-дихлородиамминплатина (II)), карбоплатин (Діамін [1,1-Циклобутандикарбоксилат]платина) і оксаліплатин ([(1R,2R)-1,2-Циклогександиамин-N,N'][оксалатно(2)-O,O']платина), мають такі хімічні структури:

Всі зазначені сполуки володіють подібним механізмом дії, зумовленим їх здатністю утворювати міцні специфічні зв'язки з ДНК, що індукують цитотоксичність.

Ці хіміопрепарати мають однаковий механізм дії і застосовуються при широкому колі онкологічних захворювань, включаючи рак яєчників, герміногенні пухлини у чоловіків і жінок, рак легенів, злоякісні новоутворення голови і шиї, рак шийки та тіла матки, молочної залози, сечового міхура, саркома м'яких тканин, меланома і колоректальний рак.

Однак зазначені препарати при застосуванні в стандартних дозуваннях володіють істотною токсичністю, що обмежує иѾв включають: шлунково-кишкові кровотечі, діарея, порушення функції печінки, нудота, блювота, судоми, периферична невропатія, неврит зорового нерва, порушення кольоросприйняття, порушення зору, лейкопенія, анемія, тромбоцитопенія та ін

Зниження токсичності похідних платини можна досягти зниженням їх дозування. Забезпечення високої ефективності терапевтичного впливу при низькій дозі хіміопрепарату створить значний соціально-економічний ефект у вигляді збереження здоров'я і діяльної життя людей, скорочення витрат на лікування.

Застосування вибраних малих інтерферуючих РНК (мірнк) для придушення обраних генів-мішеней є вихідною основою технічного результату, одержуваного за рахунок використання заявляється способу і протипухлинного засобу, що дозволяє істотно знизити дозу хіміопрепарату - похідного платини і, відповідно, звести до мінімуму його побічну дію, при підвищенні ефективності терапії.

Суть винаходу в частині способу полягає в тому, що спосіб індукції апоптозу клітин злоякісної пухлини колоректального раку передбачає інгібування функції генів клітин злоякісної пухлини з допомогою препаратів малих интерферирующиции генів з групи: c-IAP2, Livin і МСМ4, для чого використовують препарати малих інтерферуючих мірнк-олігонуклеотидів з групи:

UGUGGACAAAGUCUCUUCCdTdT; CCUGUGGGUAAGAGAUGAGdTdT; UUCUCUCUCCUCUUCCCUUAdTdT..

Переважно роблять одночасне інгібування функцій двох генів з групи: C-IAP2, Livin і МСМ4, в одній з комбінацій генів: Livin і МСМ4; C-IAP2 і МСМ4; C-IAP2 і Livin, для чого використовують препарати малих інтерферуючих мірнк-олігонуклеотидів з групи:

UGUGGACAAAGUCUCUUCCdTdT; CCUGUGGGUAAGAGAUGAGdTdT; UUCUCUCUCCUCUUCCCUUAdTdT.

В окремих випадках реалізації виробляють одночасне інгібування функцій двох генів з групи: C-IAP2, Livin і МСМ4, в одній з комбінацій генів:

Livin і MCM4; C-IAP2 і МСМ4; C-IAP2 і Livin, для чого використовують препарати малих інтерферуючих мірнк-олігонуклеотидів у вигляді дуплексів прямої та зворотної комплементарних ланцюгів нуклеотидів наступної структури:

Як правило, використовують мірнк дуплекси (duplex) синтезовані в прямому напрямку (sense, (s)) та у зворотному напрямку (antisense, (as) на основі первинної структури мРНК генів, вибраних з умови найбільшого придушення експресії гена при найменшій концентрації мірнк, причому інгібування функції двох генів клітин злоякісної пухлини здійснюють у присутності химиотера�для здійснення вищевикладеного способу для індукції апоптозу клітин злоякісної пухлини колоректального раку містить оксаліплатин і комбінацію комплементарних до мРНК у клітинах злоякісної пухлини мірнк - олігонуклеотидів у вигляді коротких петльових мірнк (shRNA), щонайменше, однієї з наступних структур:

(Sense oligo)-CAAGAGA-(Antisense oligo), або:

(Sense oligo-dtdt)-(Sense oligo)-CAAGAGA-(Antisense oligo-dtdt)-(Antisense oligo), де: Sense oligo і Antisense oligo - пари олігонуклеотидів для кожного гена, (Sense oligo-dtdt) і (Antisense oligo-dtdt) - аналогічні послідовності РНК в парах олігонуклеотидів без dtdt.

Або:

(Antisense oligo-dtdt)-(Antisense oligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo), або:

CG-(Antisense deoxyoligo-dtdt)-(Antisense deoxyoligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo)-TTTTTTGGAAA, де: Antisense deoxyoligo та Sense deoxyoligo являють собою послідовності нуклеотидів з заміною 8

рибонуклеотидов на дезоксирибонуклеотиди, (Antisense deoxyoligo-dtdt) і (Sense deoxyoligo-dtdt) - аналогічні послідовності ДНК в парах олігонуклеотидів без dtdt.

При цьому (Sense oligo) і (Antisense oligo) вибираються у відповідності з ингибируемим геном з наведених нижче:

Заявляемое засіб виконано у фармацевтичній формі, придатній для парентерального застосування з метою індукції апоптозу клітин злоякісної пухлини колоректального раку.

На кресленні фіг. 1. зображені діаграми, демонструють экспрессионний профіль генів C-IAP2 (BIRC3), Livin, (BIRC7) і МСМ4, в залежності від часу і дозування впливу оксаЂических клітин в залежності від концентрації оксаліплатину і наявності впливу мірнк на гени Livin, і МСМ4. Графіки з одними і тими ж даними, але наведені фіг. 2, 3 в різних масштабах, на графіку фіг. 2 - наведено вигляд кривих, при концентрації оксаліплатину до 100 мкм, на графіку фіг. З-наведено вигляд кривих, при концентрації оксаліплатину до 5 мкм.

При цьому технічний результат заявляються способи і засоби заснований на синергетичному дії апоптотического лікарського платиносодержащего кошти з одночасним блокуванням неконтрольованого розмноження ракових клітин, яке могло відбуватися в результаті дії конкретних антиапоптотических генів клітин пухлини, з допомогою конкретних обраних мірнк, тобто РНК-інтерференції. В останні роки були виявлені короткі фрагменти РНК (близько 21-25 нуклеотидів), які утворені з довгих молекул дволанцюжкової РНК. Ці фрагменти називаються малими интерферуючими РНК (мірнк, siRNA - short interfering RNA). Такі мірнк у складі комплексу з білками утворюють каталітичні структури, що викликають спрямовану деградацію комплементарної їм мірнк-мішені. Малі інтерферуючі РНК (мірнк) або короткі інтерферуючі РНК (англ. siRNA, small interfering RNA) - це клас дволанцюгових РНК, довжиною 20-25 нуклеотидів. Малі інтерферуючі РНК приймають учасѽо штучно синтезувати і використовувати для блокування функції цікавить гена. Білки інгібітори апоптозу - IAP (inhibitors of apoptosis proteins) відіграють дуже важливу роль у розвитку аппотоза у більшості живих організмів. Досить часто клітинні мутації призводять до підвищеної експресії генів інгібіторів апоптозу. Відповідно, мутантна ракова клітина не гине, а далі починає розмножуватися. Індукування апоптозу в ракових клітинах є одним з основних напрямків сучасної терапії раку. «Вимикання» генів - інгібіторів апоптозу та їх комбінацій повинно призводити до запрограмованої загибелі ракової клітини, особливо в умовах індукції апоптозу. Малі інтерферуючі РНК (мірнк) мають виняткову специфічністю дії щодо інгібування функції генів. Молекули мірнк у складі комплексу з білками утворюють каталітичні структури, що викликають спрямовану деградацію комплементарної їм матричної РНК-мішені (мРНК). В результаті цього винаходу сконструйований і синтезовано набір мірнк, внутрішньоклітинними мішенями яких є ряд важливих для життєздатності ракової клітини генів, включаючи антиапоптотические гени.

Відповідно до заявляемими способом і засобом запропонована група антиапоптотических генів, що інгібують апоптоз � до загибелі клітин колоректального раку при дії малих доз платиносодержащего хіміопрепарату (принципово нижче терапевтичних) за рахунок блокування запропонованих генів. З трьох генів: c-IAP2 (BIRC3), Livin, (BIRC7, ML-IAP) та МСМ4, мірнк для інгібування яких використовується в складі розроблюваного засобу, два - c-IAP2 і Livin - відносяться до генам-інгібіторів апоптозу, переважно по зовнішньому і внутрішньому шляхах, відповідно. Ці гени активуються в ракових клітинах і слабо експресуються в нормальних тканинах. Їх блокування усуває функціональні перешкоди на шляху клітини в апоптоз при стресових умовах. Ген МСМ4 відіграє істотну роль у підтримці цілісності геному, беручи участь у процесі реплікації ДНК і зупинення процесу поділу клітини для репарації дефектів при порушеннях ДНК або зупинення її синтезу (checkpoint). Порушення цих процесів інгібуванням гена МСМ4 є критичним для життєздатність ракових клітин при дефектах ДНК, що викликаються, зокрема, похідними платини. Інгібування зазначених генів дозволяє більш ніж на порядок величини зменшити дозу хіміопрепаратів - похідних платини при збереженні викликається ними апоптотического ефекту ракових клітин, що спостерігається при стандартній дозі.

Для підтвердження можливості одержання зазначеного технічного результату та переваги вибраних для реалізації способу соціально міг грати важливу роль у захисті ракової клітини від впливу хіміопрепарату. У сформовану панель увійшли гени:

- гени BIRC - сімейства (baculoviral IAP repeat-containing proteins) - з групи інгібіторів апоптозу: з-IAP1 (Birc), з-IAP2 (Birc3), з-IAP3 (Birc4), з-IAP4 (Birc5), Livin (Birc7);

- інгібітор каспази 8 - FLIP (FLIP, довга і коротка ізоформи) (FLIP, sCFL, LF);

- гени сімейства Bcl-2 (Bcl-2, Bcl-XL);

- ген Trap1 (TNFR асоційований білок), інгібітор апоптозу шляхом блокування мітохондріального стресу;

- ген c-myc, підсилює проліферацію ракових клітин;

- гени, які беруть участь у контролі цілісності геному (МСМ4, NHEJ1, ERCC1);

- ген теплового шоку (HspA5).

Для визначення рівня експресії генів при різних дозуваннях оксаліплатину були посіяні 12-лункові плашки з культурою клітин колоректального раку НТ-29. В експериментальні лунки був внесений оксаліплатин у концентраціях 1 і 5 мкм. Для підтвердження результатів, кожна така лунка була повторена не менше 3 разів і кожен експеримент був повторений не менше 3 разів.

Через 24 та 48 годин був проведений аналіз експресії генів в досліджуваних клітинах за допомогою методу ПЛР в реальному часі і отриманий экспрессионний профіль досліджуваних генів.

На основі аналізу отриманих дозових і часових залежностей експресії зазначених генів у відповідь на хіміотерапевтичне воздеазних дозах хіміопрепарату і на всьому протязі культивування продемонстрували три гена: c-IAP2, Livin і МСМ4.

На фіг.1 экспрессионний профіль генів c-IAP2, Livin, MCM4 в залежності від часу і дозування впливу оксаліплатину показує, що ці 3 гена реагують підвищенням рівня експресії більш, ніж в 2 рази і демонструють чітку залежність від дози в обох вивчених часових інтервалах.

З отриманих даних випливає, що ці гени: c-IAP2, Livin, MCM4 мають підвищену і пов'язану з дозою оксаліплатину експресію протягом усього часу інкубації, на відміну від інших досліджених генів. Це підтверджує їх особливу роль у збереженні життєздатності клітин при дії оксаліплатину. Тобто підвищення експресії розглянутих трьох генів не є проміжним або побічним етапом у розвитку процесу відповіді на токсичну дію. Саме їх підвищену функціонування необхідно для збереження життєздатності ракових клітин у певному інтервалі доз оксаліплатину на всьому протязі інкубації в його присутності.

Отже, за характеристиками дозово-часових залежностей в профілі експресії і за функціональним значенням для життєздатності ракової клітини, гени c-IAP2, Livin, MCM4 правомірно обрані в якості терапевтичних мішеней для подолання рез�рани ефективно інтерферуючі мірнк.

З метою перевірочного функціонального дослідження було проведено інгібування функції зазначених генів з допомогою мірнк. Спочатку був перевірений апоптотический ефект від інгібування функції генів c-IAP2, Livin і MCM4 окремо. В досліджувані лунки з культивованими клітинами НТ-29 вносився оксаліплатин в досліджуваних концентраціях 1 мкМ або 5 мкМ і специфічні для вказаних генів інтерферуючі мірнк в концентрації 50 мкМ. Через 48 годин після додавання оксаліплатину і мірнк, клітини прижиттєво забарвлювалися з використанням набору для визначення апоптотичних клітин Vybrant Apoptosis Assay Kit #5 (Invitrogen, USA), що включає флуоресцентні барвники Hoechst 33342/Propidium Iodide. Кількість апоптотичних клітин підраховували за допомогою флуоресцентного мікроскопа.

Найбільшим апоптотическим ефектом володіло блокування гена МСМ4. Інгібування малими интерферуючими РНК генів c-IAP2, Livin і МСМ4 при 5 мкМ оксаліплатину призводить до апоптозу клітин колоректального раку на рівнях 40%, 50% та 60% від числа всіх наявних в лунках клітин, відповідно.

При перевірці дії різних наведених нижче в таблиці комбінацій мірнк, блокуючих досліджувані гени-мішені, показано синергетична дія мірнк протиЃстойчивих до дії оксаліплатину, при 5 мкМ оксаліплатину. Отже, використання розроблюваного засобу дозволить досягати ефективної дії хіміопрепарату при дозах, менших приблизно в 15 разів, або збільшити ефект низької дози хіміопрепарату приблизно на порядок величини. Інші комбінації мірнк, блокуючі пари генів c-IAP2 і Livin; c-IAP2 і МСМ4 продемонстрували апоптоз на рівнях 60% і 65% від числа всіх клітин в лунках, відповідно.

Для інгібування функції генів були синтезовані вибрані мірнк-олигонуклеотиди, у прямому напрямку (sense) та у зворотному напрямку (antisense). При цьому мірнк sense - олигонуклеотид, 5'→3' і antisense - олигонуклеотид, 5'→3'. Послідовності олігонуклеотидів мірнк конструювали на основі послідовностей генів РНК (NCBI Reference Sequence: c-IAP2 - NM_001165.4; Livin - NM_022161.2; МСМ4 - NM_005914.3) з використанням відомих способів, наприклад, з використанням спеціалізованої програми BLOCK-iT™ RNAi Designer (Invitrogen, Life Technologies, USA).

З використанням олігонуклеотидів мірнк, синтезованих в прямому напрямку (sense, s) і в зворотному напрямку (antisense, as) створювалися дуплекси (duplex) мірнк.

Синтез олігонуклеотидів - це хімічний синтез фрагментів нуклеїнових кислот з заданої хімічної структурою (послем (найбільш поширений спосіб синтезу). Амидофосфити - будівельні блоки, які є реакционноспособними похідними дезоксирибонуклеозидов (dA, dC, dG, Т) або рибонуклеозидов (A, C, G, U) і дозволяють синтезувати короткі фрагменти ДНК і РНК, відповідно. Технологія синтезу дозволяє отримувати будь-які кількості олігонуклеотидів. По завершенні синтезу олигонуклеотид знімається з полімерного носія, з нього видаляються захисні групи (стадія деблокування), і далі він піддається очищенню за допомогою обращенно-фазової ВЕРХ або електрофорезу в поліакриламідному гелі.

Для кожного гена-мішені перевірялося кілька варіантів мірнк, це дозволяє стверджувати, що заявляється рішення передбачає найбільш ефективні. Ефективність визначалася найбільшим пригніченням експресії гена при найменшій концентрації мірнк. Всі вибрані олигонуклеотиди ингибировали відповідний ген-мішень більш ніж на 75%, тобто технічний результат заявляється способу і засобу підтверджений.

У таблиці наведено послідовності використовуються олігонуклеотидів мірнк

Ген мішеньмірнк
Sense-олигонуклеотид, 5'→3'
UUCUCUCUCCUCUUCCCUUAdTdT
LivinGGAAGAGACUUUGUCCACAdTdTUGUGGACAAAGUCUCUUCCdTdT
МСМ4CUCAUCUCUUACCCACAGGdTdTCCUGUGGGUAAGAAGAUGAGdTdT

Будь-які синтезовані олигонуклеотиди можуть бути перевірені на відповідність їх первинної структури послідовностей нуклеотидів, представленим у таблиці, а також описаним нижче конструкцій на основі представлених у таблиці олігонуклеотидів. Для цього використовують спеціальні праймери для зворотної транскрипції, що представляють собою шпилькові структури з виступаючим кінцем, наприклад, у 5-8 нуклеотидів, комплементарні послідовності кінцевого ділянки визначається олигонуклеотида мірнк.

Після проведення реакції зворотної транскрипції отримана кДНК може бути амплифицирована і потім секвенирована. Секвенування - визначення послідовності нуклеотидів в ДНК. Отримана послідовність нуклеотидів порівнюється з послідовністю в таблиці.

Заявляемое засіб являє собою комбінацію зазначених у таблиці мірнк-олігонуклеотидів розміром близько 20 нуклеотино зберігається тривалий час (роки). Наприклад, препарат для пригнічення гена c-IAP2, синтезований 16.09.2010 р. зберіг працездатність за 16.06.2013 р. (2 роки і 9 місяців). При введенні в клітку мірнк зниження експресії антиапоптического гена - мішені зберігається як мінімум три доби (72 години). Можливість кількісного визначення маси олігонуклеотидів з допомогою спектрофотометрії дозволяє повністю стандартизувати кількість і співвідношення олігонуклеотидів в різних партіях. З використанням олігонуклеотидів мірнк, синтезованих в прямому напрямку (sense, s) і в зворотному напрямку (antisense, as) створювалися дуплекси (duplex) мірнк.

Отримання дуплексів мірнк проводили в наступному розчині: 10 mM TRIS HCl; 20 mM NaCl; 1 мм EDTA (pH 8,0) при концентрації олігонуклеотидів 30-50 мкМ (http://ru-ru.invitrogen.com/site/ru/ru/home/Products-and-Services/Applications/Cell-Culture/Transfection/RNAi-Transfection/RNAi-Transfection-Protocols.html)

Крім дуплексів використовували короткі шпилькові структури, утворені на основі наведених у таблиці послідовностей sense і antisense олігонуклеотидів, позначених далі як Sense oligo і Antisense oligo, відповідно. Зазначені шпилькові структури були наступними:

(Sense oligo)-CAAGAGA-(Antisense oligo), або:

(Sense oligo-dtdt)-(Sense oligo)-CAAGAGA-(Antisense oligo-dtdt)-(Antisense oligo), де: Sense oligo і Antisense oligo - пари оліго�еотидов без dtdt.

Або:

(Antisense oligo-dtdt)-(Antisense oligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo), або:

CG-(Antisense deoxyoligo-dtdt)-(Antisense deoxyoligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo)-TTTTTTGGAAA, призначене для експресії в раковій клітині відповідних мірнк, де: Antisense deoxyoligo та Sense deoxyoligo являють собою послідовності нуклеотидів з заміною рибонуклеотидов на дезоксирибонуклеотиди, (Antisense deoxyoligo-dtdt) і (Sense deoxyoligo-dtdt) - аналогічні послідовності ДНК в парах олігонуклеотидів без dtdt.

При цьому (Sense oligo) і (Antisense oligo) вибираються у відповідності з ингибируемим геном з наведених у таблиці.

Трансфекцію клітин синтетичними олигонуклеотидами (мірнк) проводили липосомним методом згідно з протоколом (www.invitrogen.com/.../lipofectamine-rnaimax) виробника з використанням реагентів Lipofectamine RNAiMAX ("Invitrogen", США). Ці реагенти комерційно доступні. Даний реагент (Lipofectamine RNAiMAX) був обраний, виходячи з його характеристик:

Основна характеристика Lipofectamine™ RNAiMAX: Висока ефективність трансфекції малих РНК (siRNA та miRNA) в усі типи клітин, включаючи стабільні клітинні лінії, первинні, стовбурові і важко трансфицируемие клітини. Трансфекція робилася прямим методом, тобто суміш для трансфекції вносили безпосередньо у середу з клітинами. За 2 дні до експерименту �фекцией живильне середовище з 10% сироваткою замінювали на ту ж середу з 1% сироваткою, згідно з протоколом. Трансфекція - процес уведення нуклеїнової кислоти у клітини людини і тварин невирусним методом

Для приготування трансфецирующего реагенту, дуплекси мірнк (10-50 пмоль) розводили з Lipofectamine RNAiMAX (2 мкл/лунку) в 200 мкл середовища ДМЕМ з пониженим вмістом сироватки (1%). Далі ця суміш протягом 20 хв перемішувалася при кімнатній температурі. Отриману суміш вносили в плашку з клітинами (конфлюентность - 20%-40%), плашка містилася в термостат, через 20 хв додавалося 800 мкл середовища з необхідною концентрацією хіміопрепарату. Оксаліплатин наносився в різних концентраціях залежно від мети експерименту (0,3 мкм, 1 мкм, 5 мкм, 20 мкм, 50 мкм, 100 мкм, 150 мкм, 250 мкм). Підрахунок результатів проводили через 24, 48 і 72 години після додавання оксаліплатину.

В результаті показано, що засіб, що забезпечує спільну дію мірнк, що інгібують гени Livin і МСМ4, при малих дозах оксаліплатину (5 мкм) дає порівнянний ефект з окремою дозуванням оксаліплатину, що становить 80 мкм. Отримані дані демонструють, що заявляється протипухлинний засіб на основі мірнк може розглядатися в якості ефективного інструменту для терапії раку, включаючи посилення терапевтичного е одноразова доза оксаліплатину для людини становить приблизно 150 мг (у відповідності з інструкцією на оксаліплатин-тева максимальна доза становить 85 мг/1 м2площі тіла, середня площа тіла 1,73 м2- ru.wikipedia.org/wiki/плошадь_поверхности_тела). Виходячи з кількості крові у людини (близько 5 л), введення 150 мг оксаліплатину призведе до його концентрації у крові, який становить 30 мкг/мл, або 75 мкМ. Тобто ефективна концентрація оксаліплатину в крові відповідає його концентрації в культурі ракових клітин, що призводить до їх суттєвого загибелі (фіг.2, 3). При використанні аналогічного розрахунку для дуплексів мірнк, їх доза, необхідна для досягнення ефективного впливу при лікуванні людини, складе близько 8 мг при одночасному введенні менше 10 мг оксаліплатину (в 15 разів менше стандартної дози). Оксаліплатин у стандартній дозі вводять 1 раз на два тижні протягом 12 циклів. Аналогічно може вводитися і розроблений засіб на основі мірнк. Однак суттєве зниження дози оксаліплатину при одночасному використанні мірнк може дозволити застосовувати ці засоби 1 раз на тиждень протягом 12 циклів, що призведе до підвищення ефективності терапії при одночасному скороченні його тривалості.

Переважно, засіб являє собою стандартну дозувальну форму, що включає добову дозу або стандартну добову су�, � формі фармацевтичного складу, що включає активний інгредієнт, в фармацевтично прийнятною лікарській формі. В залежності від захворювання пацієнта, якому призначено лікування, а також способу введення, композиції можуть застосовуватися в різних дозах.

При лікуванні людини, засіб може застосовуватися окремо, але в загальному можуть застосовуватися в суміші з відповідним фармацевтичним наповнювачем, розчинником або носієм, обраним по відношенню до призначеного способу введення і стандартної фармацевтичній практиці.

Засіб по справжньому винаходу можна також вводити з допомогою липосомной доставки.

Засіб можна використовувати в поєднанні з розчинними полімерами в якості носіїв. Такі полімери можуть включати полівінілпіролідон. сополімер пірана, полигидроксипропилметакриламидфенол, полигидроксиэтиласпартамидфенол або полиэтиленоксидполилизин. Засіб можна використовувати з биоразлагаемими полімерами для контрольованого вивільнення лікарського засобу, наприклад, метаболизируемими ліпідами, що містять похідні гліцерину, стеролів і длинноцепних спиртів; полімером молочної кислоти, полімером гліколевої кислоти, сопов або суспензій, які можуть включати агенти, для застосування з швидким, уповільненим або контрольованим вивільненням. Засіб може також вводитися ректально або за допомогою интраопухолевой ін'єкції.

Засіб може застосовуватися в желатинових капсулах. Кращі в цьому відношенні допоміжні речовини містять лактозу, крохмаль, целюлозу, молочний цукор, ліпіди або полиэтиленгликоли з високою молекулярною масою. Для водних суспензій з'єднання винаходу можуть бути об'єднані з різними агентами, із емульгуючими та/або суспендирующими агентами і розчинниками, такими як вода, етанол, пропіленгліколь і гліцерин, та їх комбінаціями.

Засіб може застосовуватися парентерально, наприклад, внутрішньовенно, інтра-артериально, або можуть застосовуватися інфузійних способом. Найкращим способом препарат може застосовуватися у формі стерильного водного розчину, який може включати інші речовини, наприклад, достатню кількість солей або глюкози для забезпечення изотонии розчину з кров'ю. Водні розчини повинні бути забуферени підходящим способом (переважно до pH від 3 до 9), якщо необхідно. Приготування відповідних парентеральних складів у стерильних умовах легко достигр>

Склади можуть бути представлені в контейнерах для стандартної дози або безлічі доз, наприклад, в запаяних ампулах і флаконах, і можуть зберігатися в ліофілізованому стані, що вимагає тільки додавання стерильного рідкого носія, наприклад, води для ін'єкцій, негайно перед застосуванням. Розчини та суспензії для введення, що готуються безпосередньо перед застосуванням, можуть бути приготовлені з стерильних порошків і гранул раніше описаного типу.

Для парентерального застосування у пацієнтів-людей, рівень разової дози кошти зазвичай може становити від 0,1 мг/кг до 10 мг/кг. Так, наприклад, із з'єднання капсули винаходу можуть включати дозу активного з'єднання для прийому окремо або в подвійному і більшому обсязі за один раз, як необхідно. Лікар у кожному випадку визначає необхідне дозування, найбільш підходящу для кожного окремого пацієнта і вона може змінюватися залежно від віку, ваги і відповіді конкретного пацієнта. Вищевказані дозування є зразковими для середнього випадку. Можуть, звичайно, бути окремі випадки, потрібні більш високі або низькі діапазони дозування, і такі випадки відносяться до області даного винаходу.

Для ветери�нарной практикою, і ветеринарний лікар визначає режим дозування і спосіб введення, найбільш придатні для конкретної тварини.

Результат винаходу полягає в оптимізації та активізації апоптотического впливу платиносодержащего лікарського засобу на клітини пухлини колоректального раку за рахунок того, що блокуванням відповідних генів забезпечується істотна апоптотическая загибель ракових клітин при дозі лікарського засобу, принципово нижче стандартної. Таким чином, досягається зниження токсичності при збереженні або підвищенні ефективності терапії. Це досягається завдяки одночасному впливу на конкретні антиапоптотические гени (ингибируемий ген-мішень, його мРНК, тобто РНК-мішень) в клітці пухлини з допомогою інтерферуючих РНК (мірнк, siRNA - small interfering RNA), що тягне за собою скорочення тривалості лікування до отримання значущих результатів, при зниженні ймовірності побічних явищ.

1. Спосіб індукції апоптозу клітин злоякісної пухлини колоректального раку, передбачає інгібування функції генів клітин злоякісної пухлини з допомогою препаратів малих інтерферуючих РНК у присутності хіміотерапевтичного платинового Ѐепарати малих інтерферуючих мірнк-олігонуклеотидів з групи: UGUGGACAAAGUCUCUUCCdTdT; CCUGUGGGUAAGAGAUGAGdTdT; UUCUCUCUCCUCUUCCCUUAdTdT.

2. Спосіб за п. 1, який відрізняється тим, що проводять одночасне інгібування функцій двох генів з групи: C-IAP2, Livin і МСМ4, в одній з комбінацій генів: Livin і МСМ4; C-IAP2 і МСМ4; C-IAP2 і Livin, для чого використовують препарати малих інтерферуючих мірнк-олігонуклеотидів з групи: UGUGGACAAAGUCUCUUCCdTdT; CCUGUGGGUAAGAAGAUGAGdTdT; UUCUCUCUCCUCUUCCCUUAdTdT.

3. Спосіб за будь-яким із пп. 1, 2, який відрізняється тим, що проводять одночасне інгібування функцій двох генів з групи: C-IAP2, Livin і МСМ4, в одній з комбінацій генів: Livin і МСМ4; C-IAP2 і МСМ4; C-IAP2 і Livin, для чого використовують препарати малих інтерферуючих мірнк-олігонуклеотидів у вигляді дуплексів прямої та зворотної комплементарних ланцюгів нуклеотидів наступної структури:

4. Спосіб за п. 3, який відрізняється тим, що використовують мірнк дуплекси (duplex), синтезовані в прямому напрямку (sense, (s)) та у зворотному напрямку (antisense, (as) на основі первинної структури мРНК генів, вибраних з умови найбільшого придушення експресії гена при найменшій концентрації мірнк.

5. Спосіб за будь-яким із пп. 1, 2, 4, який відрізняється тим, що інгібування функції двох генів клітин злоякісної пухлини здійснюють у присутності химиотерапевтическолокачественной пухлини колоректального раку, містить оксаліплатин і комбінацію комплементарних до мРНК у клітинах злоякісної пухлини мірнк - олігонуклеотидів у вигляді коротких петльових мірнк (shRNA), щонайменше, однієї з наступних структур:
(Sense oligo)-CAAGAGA-(Antisense oligo), або:
(Sense oligo-dtdt)-(Sense oligo)-CAAGAGA-(Antisense oligo-dtdt)-(Antisense oligo), де: Sense oligo і Antisense oligo - пари олігонуклеотидів для кожного гена, (Sense oligo-dtdt) і (Antisense oligo-dtdt) - аналогічні послідовності РНК в парах олігонуклеотидів без dtdt.
Або:
(Antisense oligo-dtdt)-(Antisense oligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo), або:
CG-(Antisense deoxyoligo-dtdt)-(Antisense deoxyoligo)-CAAGAGA-(Sense deoxyoligo-dtdt)-(Sense deoxyoligo)-TTTTTTGGAAA, де: Antisense deoxyoligo та Sense deoxyoligo являють собою послідовності нуклеотидів з заміною рибонуклеотидов на дезоксирибонуклеотиди, (Antisense deoxyoligo-dtdt) і (Sense deoxyoligo-dtdt) - аналогічні послідовності ДНК в парах олігонуклеотидів без dtdt.
При цьому (Sense oligo) і (Antisense oligo) вибираються у відповідності з ингибируемим геном з наведених нижче:

7. Засіб по п. 6, відрізняється тим, що воно виконано у фармацевтичній формі, придатній для парентерального застосування з метою індукції апоптозу клітин злоякісної пухлини колоректального раку.



 

Схожі патенти:

Спосіб видалення забруднює нуклеїнової кислоти з реакції зворотної транскрипції і ампліфікації

Винахід відноситься до біотехнології і являє собою ДНКазу або її ферментативно активний фрагмент, способи видалення забруднює нуклеїнової кислоти з реакції зворотної транскрипції, в яких використовується дана ДНКаза, нуклеїнову кислоту, що кодує зазначену ДНКазу, і набори або композиції, що містять зазначену ДНКазу. Зазначена ДНКаза являє собою ДНКазу, яка має послідовність SEQ ID NO: 1, або ферментативно активний варіант SEQ ID NO: 1, має послідовність, яка щонайменше на 95% ідентична їй, але де пролиновий залишок у положенні 237 в SEQ ID NO: 1 або еквівалентний пролін в інших послідовностях заміщений, і де зазначена ДНКаза або її ферментативно активний фрагмент по суті необоротно інактивуються шляхом нагрівання при температурі близько 50°С протягом 5 хв у буфері, що складається з 25 мМ Tris/HCI, pH 8,5, 5 мМ MgCl2, 1 мМ DTT, і які по суті специфічні щодо дволанцюжкової ДНК. Запропоноване винахід дозволяє з високою ефективністю видаляти забруднює ДНК з реакційних сумішей для зворотної транскрипції, препаратів ДНК-полімерази з гарячим стартом і реакційних сумішей для ПЛР з гарячим стартом. 13 н. і 22 з.п. ф-ли, 19 іл., 9 пр.

Нові il-17-зв'язуючі сполуки та їх медичне застосування

Винахід відноситься до біотехнології, а саме до нових IL-17-інгібуючим поліпептидів, відповідним злитим білків, до композицій і застосування їх у медичних цілях. Поліпептид містить аминокислотную послідовність, яку вибирають із групи, що складається з GVTLFVALYD YKAFWPGDLS FHKGEKFQIL RTSDGDWWEA RSLTTGETGY IPSNYVAPVD SIQ (SEQ ID NO: 39), GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWVA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO:57) або GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWIA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO: 107); амінокислотної послідовності, що має, щонайменше, 80%, переважно, щонайменше, 90%, більш переважно, щонайменше, 95% ідентичність амінокислотної послідовності з SEQ ID NO: 39, SEQ ID NO:57 або SEQ ID NO: 107; фрагмента або похідного функціонального SEQ ID NO: 39, SEQ ID NO:57 або SEQ ID NO: 107, одержуваного за рахунок заміщення, додавання і видалення не більше ніж 5 амінокислот. Запропоноване винахід дозволяє з високою специфічністю і аффинностью пов'язувати IL-17. 12 н. і 21 з.п. ф-ли, 17 іл., 3 табл., 12 пр.

Рнк-аптамери, що володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла

Винахід відноситься до галузі біотехнології та медицини і стосується РНК-аптамери. Запропонований РНК-аптамери являє собою 57-звенний олигонуклеотид змішаного типу, що має нуклеотидну послідовність GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, де A,G - рибонуклеотиди, U, С - 2'-дезокси-2'-фторрибонуклеотиди, володіє здатністю дізнаватися характерні для розсіяного склерозу аутоантитіла. Охарактеризованное винахід специфічно і високоафинно зв'язується з аутоантителами, характерними для розсіяного склерозу і може бути використане для діагностики розсіяного склерозу. 3 іл., 2 пр.

Спосіб генотипування штамів mycobacterium tuberculosis

Винахід відноситься до галузі медицини, фтизіатрії та медичної мікробіології і стосується способу генотипування штамів Mycobacterium tuberculosis. Охарактеризований спосіб заснований на однонуклеотидном поліморфізм генів систем токсин-антитоксин II типу суперсемейств VapBC, HigAB і MazEF і характеризується тим, що для ідентифікації проводять ампліфікацію з геномної ДНК з використанням набору олігонуклеотидних праймерів для 10 генів систем токсин-анатоксин. ПЛР продукти аналізують в агарозному гелі, розмір отриманого фрагмента визначають за допомогою ДНК-маркера, виділяють цільові фрагменти з ПЛР-суміші або агарозного гелю і секвенируют їх з метою виявлення відповідних поліморфізмів. Запропоноване винахід дозволяє точно і швидко проводити генотипування мікобактерій в режимі ПЛР і може бути використано для ідентифікації клінічно значущих штамів M. tuberculosis, у тому числі з множинною і широкою лікарською стійкістю, а також із зміненою вірулентністю при роботі з пацієнтами. 1 іл., 3 табл., 5 пр.

Зв'язує мср-1 нуклеїнова кислота та її застосування

Група винаходів відноситься до галузі біотехнології та медицини. Введення суб'єкту молекули нуклеїнової кислоти при лікуванні вовчакового нефриту, яка здатна зв'язуватися з MCP-1 і є антагоністом МСР-1, де молекула нуклеїнової кислоти містить послідовність нуклеїнової кислоти SEQ ID NO:37 спільно з імуносупресивний засобом, що дозволяє знизити дозу імуносупресивної кошти. Введення суб'єкту молекули нуклеїнової кислоти, де молекула нуклеїнової кислоти містить послідовність нуклеїнової кислоти SEQ ID NO:37, також надає терапевтичний ефект при лікуванні легеневої гіпертензії і хронічному обструктивному захворюванні легень. 6 н. і 24 з.п. ф-ли, 54 іл., 1 табл., 12 пр.

Дискримінує мішень зонд, спосіб його конструювання і спосіб детекції нуклеиновокислотной послідовності-мішені (варіанти)

Група винаходів стосується дискриминирующего мішень зонда (TD-зонду), способу його конструювання і способів детекції нуклеиновокислотной послідовності-мішені з його використанням. TD-зонд гибридизуется з нуклеиновокислотной послідовністю-мішенню як через 5'-кінцевий друга ділянка гібридизації, так і 3'-кінцевий перший ділянка гібридизації. Коли TD-зонд гибридизуется з нуклеиновокислотной послідовністю, не є мішенню, тоді і 5'-кінцевий друга ділянка гібридизації, і розділовий ділянку обидва не гибридизуются з нуклеиновокислотной послідовністю, не є мішенню, тому що обидві ділянки утворюють єдину ланцюг внаслідок низької величини своєї Тпл. Представлені винаходи дозволяють підвищити специфічність гібридизації і можуть бути використані в області клінічної діагностики і генетичних досліджень. 7 н. і 32 з.п. ф-ли, 14 іл., 9 пр.

Димерная окклюдантная наноструктура, міченна молекулою, активної щодо рамановского розсіювання, локалізованої в межчастичном з'єднанні, її використання і спосіб її отримання

Винахід відноситься до галузі молекулярної біології і біохімії. Запропоновано димерная наноструктура, спосіб її конструювання, спосіб детектування аналіту і набір для визначення аналіта. Винахід дозволяє підвищити чутливість та точність детектування одиничних молекул. 4 н. і 19 з.п. ф-ли, 6 іл., 4 пр.

Високоспецифічний днк-маркер, який використовується в якості ендогенного референсного контролю для виявлення геномної днк картоплі в рослинному матеріалі та харчових продуктах, у тому числі при ідентифікації гмо

Винахід відноситься до галузі біохімії, зокрема до біологічного ДНК маркеру для виявлення геномної ДНК картоплі S. tuberosum і споріднених дикоростучих видів роду Solanum секти. Petota в рослинному матеріалі та харчових продуктах, що представляє собою олігонуклеотидні праймери - затравки полімеразної реакції SEQ ID №1 - 5'-CAAAAACAAACTGAACGAACATGCATTC-3' SEQ ID №2 - 5'GCGTTGACGTTCACACGGATG-3', дозволяють амплифицировать ген Sus4 у культурної картоплі S. tuberosum і споріднених дикоростучих видів роду Solanum секти. Petota, а також у продуктах переробки картоплі, і таким чином ідентифікувати ДНК картоплі. Винахід дозволяє ефективно виявляти геномну ДНК картоплі S. tuberosum і споріднених дикоростучих видів роду Solanum секти. Petota в рослинному матеріалі та харчових продуктах. 4 іл., 1 прим.

Набори олігонуклеотидів-праймерів і зондів, біологічний мікрочіп і тест-система для ідентифікації та типування вірусу грипу а і в з їх використанням

Представлені набори олігонуклеотидних зондів і праймерів, біологічний мікрочіп і тест-система для ідентифікації та типування вірусу грипу А і В. Охарактеризована тест-система містить: набір реагентів для виділення РНК вірусу грипу з біологічного матеріалу людини; набір реагентів для проведення ПЛР-ампліфікації, поєднаної зі зворотною транскрипцією, з утворенням флуоресцентно-мічених фрагментів геному вірусу грипу, який містить описані олигонуклеотиди-праймери; набір реагентів для проведення гібридизації фрагментів ДНК, отриманих після проведення ампліфікації на биочипе, що містить елементи з іммобілізованими описаними олигонуклеотидними зондами; при необхідності, негативний і позитивний контрольні зразки. Представлені винаходи забезпечують більш доступний і простий метод аналізу з високою специфічністю і низькою вартістю. 4 н. п. ф-ли, 2 іл., 2 табл., 4 пр.

Молекула rnai, нацеливающая тимидилатсинтазу та її застосування

Винахід відноситься до галузі молекулярної біології і генної інженерії. Запропоновано молекула RNAi для супресії експресії тимидилатсинтази за рахунок дії RNAi, що містить домен дволанцюжкової РНК, що складається з смисловий ланцюга, що складається з нуклеотидної послідовності, представленої SEQ ID NO: 1, гибридизованной з антисмислової ланцюгом, гибрідизуючою в жорстких умовах зі змістовної ланцюгом. Молекула може істотно потенціювати протипухлинну дію 5-FU-протипухлинного агента, у зв'язку з чим може бути використана в медицині при протипухлинної терапії. 5 н. і 10 з.п. ф-ли, 2 іл., 3 пр.
Up!